Mutagenetix > Incidental Mutations

Incidental Mutation 'R6375:Eml5'

535642

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.339) question?

Stock #

R6375 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

DNA Base Change (assembly)

T to C at 98798868 bp

Zygosity

Heterozygous

Amino Acid Change

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

100% (45/45)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	A	17: 24,387,562	I797N	possibly damaging	Het
Actbl2	A	G	13: 111,255,944	E271G	probably damaging	Het
Aplp2	T	C	9: 31,157,788	N526D	probably benign	Het
Cacna1e	A	C	1: 154,479,305	N389K	probably damaging	Het
Ccdc18	T	C	5: 108,174,954	I640T	possibly damaging	Het
Ccdc39	T	A	3: 33,814,367	T857S	probably benign	Het
Ccser1	T	A	6: 61,311,168	L105*	probably null	Het
Efhc1	T	A	1: 20,972,940	M361K	probably benign	Het
Fgfr2	C	A	7: 130,167,745	L637F	probably damaging	Het
Fmo9	A	G	1: 166,664,595		probably null	Het
Gm4302	A	G	10: 100,341,396	T181A	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Hoxb4	A	G	11: 96,320,327	*251W	probably null	Het
Il1r1	T	A	1: 40,294,890	Y207N	probably damaging	Het
Kcnc2	C	T	10: 112,463,189	T622M	possibly damaging	Het
Kcnk9	C	T	15: 72,546,243	A13T	probably benign	Het
Kdm4c	C	T	4: 74,330,715	P69S	probably damaging	Het
Kmt2e	T	C	5: 23,499,519	S1237P	probably benign	Het
Lrrc37a	G	A	11: 103,501,089	T1170I	probably benign	Het
Lyn	T	A	4: 3,745,527	F109I	probably damaging	Het
Lynx1	T	C	15: 74,751,319	Y88C	probably damaging	Het
Mon1b	T	A	8: 113,638,077	I162N	probably damaging	Het
Muc4	A	G	16: 32,736,243		probably benign	Het
Nbn	T	A	4: 15,979,327	F437L	probably benign	Het
Neil3	T	C	8: 53,587,276	K564E	possibly damaging	Het
Nfe2l1	A	T	11: 96,820,051	S293T	probably damaging	Het
Olfr121	T	A	17: 37,752,099	S82T	probably benign	Het
Olfr292	C	T	7: 86,695,059	A201V	probably benign	Het
Olfr577	T	C	7: 102,973,753	T80A	probably damaging	Het
Olfr706	C	A	7: 106,886,014	A268S	probably benign	Het
Pcdhb22	A	T	18: 37,518,304		probably benign	Het
Pcdhgb6	A	G	18: 37,742,625	N129D	probably damaging	Het
Pias2	C	T	18: 77,152,670	T574M	possibly damaging	Het
Plec	G	A	15: 76,177,640	T2564I	probably damaging	Het
Qrich2	A	G	11: 116,458,228		probably benign	Het
Scgb1b12	T	A	7: 32,334,459	V48E	probably damaging	Het
Scn5a	A	T	9: 119,543,356	L224Q	probably damaging	Het
Snx3	T	A	10: 42,534,731	Y132*	probably null	Het
Stk39	T	A	2: 68,392,238	I161F	probably benign	Het
Tcaf2	A	C	6: 42,626,178	L816R	probably damaging	Het
Thap4	C	A	1: 93,725,156		probably null	Het
Tmc5	T	A	7: 118,656,814	V704E	probably damaging	Het
Tmem39a	A	G	16: 38,585,237	T59A	probably benign	Het
Tshz2	A	G	2: 169,886,019	N376S	probably damaging	Het
Vmn1r60	T	C	7: 5,545,018	N28D	probably damaging	Het
Zfp637	C	T	6: 117,845,324	R138W	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGAGTCTACACAGATAACAATG -3'
(R):5'- AGCAGGTGACCTAGCATTCC -3'

Sequencing Primer
(F):5'- GAGTAATTTAGCCTGCACAGCCTAG -3'
(R):5'- CACCCACATAGAGGATGACATCTGTG -3'

Posted On

2018-09-21