Incidental Mutation 'R6438:Miga1'
ID535643
Institutional Source Beutler Lab
Gene Symbol Miga1
Ensembl Gene ENSMUSG00000054942
Gene Namemitoguardin 1
SynonymsC030011O14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6438 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location152273849-152340407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152322403 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 163 (D163G)
Ref Sequence ENSEMBL: ENSMUSP00000072836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068243] [ENSMUST00000073089] [ENSMUST00000199334]
Predicted Effect probably damaging
Transcript: ENSMUST00000068243
AA Change: D163G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068261
Gene: ENSMUSG00000054942
AA Change: D163G

DomainStartEndE-ValueType
Pfam:DUF2217 26 306 6.3e-74 PFAM
Pfam:DUF2217 298 507 2.8e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073089
AA Change: D163G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072836
Gene: ENSMUSG00000054942
AA Change: D163G

DomainStartEndE-ValueType
Pfam:DUF2217 27 571 4.8e-245 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199334
AA Change: D163G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143238
Gene: ENSMUSG00000054942
AA Change: D163G

DomainStartEndE-ValueType
Pfam:DUF2217 26 496 1.2e-179 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik C T 14: 8,431,701 V644M probably damaging Het
Ado A T 10: 67,548,541 I78N probably damaging Het
Arhgap18 T C 10: 26,772,698 probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atxn2 T A 5: 121,779,432 I463N probably damaging Het
B3gnt4 G A 5: 123,511,591 E340K probably benign Het
C1ra C T 6: 124,513,777 T43I possibly damaging Het
C6 T A 15: 4,796,983 Y683N possibly damaging Het
Cdk12 T A 11: 98,224,467 Y811* probably null Het
Chd9 A T 8: 90,998,521 E1159D probably benign Het
Efcab7 T A 4: 99,909,772 S505T probably benign Het
Erich3 A T 3: 154,695,753 Y13F probably damaging Het
Esco1 A T 18: 10,572,031 C770S probably damaging Het
Evpl C A 11: 116,230,101 R436L probably benign Het
Fam185a T A 5: 21,458,972 probably null Het
Gm16432 T C 1: 178,111,303 Y581H possibly damaging Het
Gm17078 A G 14: 51,611,238 V14A probably benign Het
Hectd2 T C 19: 36,618,842 *776Q probably null Het
Ldb2 T C 5: 44,480,310 R219G probably damaging Het
Lrrn4 T C 2: 132,870,142 E587G probably damaging Het
Malrd1 T C 2: 15,614,206 S294P Het
Map7 A G 10: 20,267,257 E384G unknown Het
Myo7b G A 18: 31,966,329 S1680F probably damaging Het
Nell2 C T 15: 95,232,498 V665M probably damaging Het
Npas3 T C 12: 54,068,698 V770A probably damaging Het
Pcm1 C T 8: 41,325,381 R1818W possibly damaging Het
Slc4a9 T A 18: 36,535,687 N701K probably benign Het
Slc5a9 A G 4: 111,891,825 V187A probably benign Het
Slf1 A T 13: 77,066,606 C654S probably damaging Het
Srek1ip1 A G 13: 104,837,370 Y95C probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Tmem168 A T 6: 13,602,674 I231N probably benign Het
Usp34 T C 11: 23,364,266 M717T probably benign Het
Zfp672 T C 11: 58,316,737 T253A probably benign Het
Other mutations in Miga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Miga1 APN 3 152276690 missense probably benign 0.18
IGL01461:Miga1 APN 3 152335297 missense probably damaging 1.00
IGL02962:Miga1 APN 3 152285341 splice site probably benign
R0165:Miga1 UTSW 3 152290843 missense probably damaging 0.99
R0945:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1527:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1769:Miga1 UTSW 3 152287554 missense probably damaging 1.00
R1978:Miga1 UTSW 3 152335304 frame shift probably null
R3697:Miga1 UTSW 3 152322436 missense probably damaging 0.99
R4649:Miga1 UTSW 3 152279005 missense probably benign 0.28
R4660:Miga1 UTSW 3 152287518 missense probably damaging 1.00
R4679:Miga1 UTSW 3 152322475 missense probably damaging 1.00
R4815:Miga1 UTSW 3 152290806 missense probably benign 0.00
R5019:Miga1 UTSW 3 152322461 missense possibly damaging 0.86
R5488:Miga1 UTSW 3 152333446 small deletion probably benign
R6107:Miga1 UTSW 3 152335399 missense probably benign 0.03
R6227:Miga1 UTSW 3 152278949 missense probably benign 0.09
R6292:Miga1 UTSW 3 152317719 missense probably benign 0.30
R6444:Miga1 UTSW 3 152283831 missense probably damaging 1.00
R6489:Miga1 UTSW 3 152279008 missense probably damaging 0.99
R6564:Miga1 UTSW 3 152285322 missense probably damaging 1.00
R7354:Miga1 UTSW 3 152290500 missense probably damaging 1.00
R7440:Miga1 UTSW 3 152338046 critical splice acceptor site probably null
R7638:Miga1 UTSW 3 152276687 missense probably benign 0.00
R8039:Miga1 UTSW 3 152276756 missense probably benign 0.15
R8154:Miga1 UTSW 3 152320700 unclassified probably benign
R8418:Miga1 UTSW 3 152285317 missense probably damaging 1.00
R8423:Miga1 UTSW 3 152322408 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTATCCTCCACAGGCTGGG -3'
(R):5'- CAGATTTGGCATGGACTTCAGG -3'

Sequencing Primer
(F):5'- TCCACAGGCTGGGGCTAAAAC -3'
(R):5'- TAGCATGCCTGAAACTCTGG -3'
Posted On2018-09-24