Incidental Mutation 'R6438:Fam185a'
ID535644
Institutional Source Beutler Lab
Gene Symbol Fam185a
Ensembl Gene ENSMUSG00000047221
Gene Namefamily with sequence similarity 185, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6438 (G1)
Quality Score76.0075
Status Validated
Chromosome5
Chromosomal Location21424958-21482124 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 21458972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056045]
Predicted Effect probably null
Transcript: ENSMUST00000056045
SMART Domains Protein: ENSMUSP00000058333
Gene: ENSMUSG00000047221

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik C T 14: 8,431,701 V644M probably damaging Het
Ado A T 10: 67,548,541 I78N probably damaging Het
Arhgap18 T C 10: 26,772,698 probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atxn2 T A 5: 121,779,432 I463N probably damaging Het
B3gnt4 G A 5: 123,511,591 E340K probably benign Het
C1ra C T 6: 124,513,777 T43I possibly damaging Het
C6 T A 15: 4,796,983 Y683N possibly damaging Het
Cdk12 T A 11: 98,224,467 Y811* probably null Het
Chd9 A T 8: 90,998,521 E1159D probably benign Het
Efcab7 T A 4: 99,909,772 S505T probably benign Het
Erich3 A T 3: 154,695,753 Y13F probably damaging Het
Esco1 A T 18: 10,572,031 C770S probably damaging Het
Evpl C A 11: 116,230,101 R436L probably benign Het
Gm16432 T C 1: 178,111,303 Y581H possibly damaging Het
Gm17078 A G 14: 51,611,238 V14A probably benign Het
Hectd2 T C 19: 36,618,842 *776Q probably null Het
Ldb2 T C 5: 44,480,310 R219G probably damaging Het
Lrrn4 T C 2: 132,870,142 E587G probably damaging Het
Malrd1 T C 2: 15,614,206 S294P Het
Map7 A G 10: 20,267,257 E384G unknown Het
Miga1 T C 3: 152,322,403 D163G probably damaging Het
Myo7b G A 18: 31,966,329 S1680F probably damaging Het
Nell2 C T 15: 95,232,498 V665M probably damaging Het
Npas3 T C 12: 54,068,698 V770A probably damaging Het
Pcm1 C T 8: 41,325,381 R1818W possibly damaging Het
Slc4a9 T A 18: 36,535,687 N701K probably benign Het
Slc5a9 A G 4: 111,891,825 V187A probably benign Het
Slf1 A T 13: 77,066,606 C654S probably damaging Het
Srek1ip1 A G 13: 104,837,370 Y95C probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Tmem168 A T 6: 13,602,674 I231N probably benign Het
Usp34 T C 11: 23,364,266 M717T probably benign Het
Zfp672 T C 11: 58,316,737 T253A probably benign Het
Other mutations in Fam185a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Fam185a APN 5 21480342 missense probably damaging 1.00
IGL01980:Fam185a APN 5 21459173 missense probably damaging 1.00
IGL02096:Fam185a APN 5 21425343 missense probably damaging 1.00
IGL02264:Fam185a APN 5 21480394 missense possibly damaging 0.63
IGL02553:Fam185a APN 5 21455831 missense probably damaging 1.00
IGL02553:Fam185a APN 5 21429841 splice site probably benign
IGL03082:Fam185a APN 5 21455838 missense possibly damaging 0.49
famine UTSW 5 21425454 missense probably benign 0.00
R0389:Fam185a UTSW 5 21459285 missense probably damaging 0.99
R1872:Fam185a UTSW 5 21480330 critical splice acceptor site probably null
R1883:Fam185a UTSW 5 21425244 missense possibly damaging 0.85
R3775:Fam185a UTSW 5 21455806 missense probably damaging 1.00
R4190:Fam185a UTSW 5 21425124 unclassified probably benign
R4192:Fam185a UTSW 5 21425124 unclassified probably benign
R4194:Fam185a UTSW 5 21425454 missense probably benign 0.00
R4704:Fam185a UTSW 5 21480473 utr 3 prime probably benign
R4724:Fam185a UTSW 5 21455787 missense probably damaging 1.00
R4837:Fam185a UTSW 5 21480377 missense probably benign 0.00
R6225:Fam185a UTSW 5 21425556 missense probably damaging 0.99
R6475:Fam185a UTSW 5 21425283 missense probably benign 0.01
R7512:Fam185a UTSW 5 21447358 critical splice donor site probably null
R8400:Fam185a UTSW 5 21438816 missense probably benign 0.14
R8690:Fam185a UTSW 5 21433768 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ACAGGCTTTGGAGACACTGC -3'
(R):5'- TGACAGCAATAGAACCTGTGG -3'

Sequencing Primer
(F):5'- TTGGAGACACTGCACTATGC -3'
(R):5'- CCTGTGGCAAATTTAGAGTGAAAC -3'
Posted On2018-09-24