Incidental Mutation 'R6244:Mapk8ip1'
ID535657
Institutional Source Beutler Lab
Gene Symbol Mapk8ip1
Ensembl Gene ENSMUSG00000027223
Gene Namemitogen-activated protein kinase 8 interacting protein 1
SynonymsMAPK8IP1, IB1, Jip1, mjip-2a, Prkm8ip, Skip, JIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R6244 (G1)
Quality Score50.0072
Status Validated
Chromosome2
Chromosomal Location92383676-92401263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92389244 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 81 (G81C)
Ref Sequence ENSEMBL: ENSMUSP00000050773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050312] [ENSMUST00000111279] [ENSMUST00000111280]
PDB Structure
Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform complex with a biaryl tetrazol (A-82118) [X-RAY DIFFRACTION]
Structural and functional analysis of quercetagetin, a natural JNK1 inhibitor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000050312
AA Change: G81C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050773
Gene: ENSMUSG00000027223
AA Change: G81C

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
low complexity region 71 87 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
SH3 487 544 2.62e-11 SMART
PTB 558 700 1.2e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111279
AA Change: G72C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106910
Gene: ENSMUSG00000027223
AA Change: G72C

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 62 78 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
low complexity region 233 245 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
SH3 478 535 2.62e-11 SMART
PTB 549 691 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111280
SMART Domains Protein: ENSMUSP00000106911
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183506
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of the pancreatic beta-cell function. It is highly similar to JIP-1, a mouse protein known to be a regulator of c-Jun amino-terminal kinase (Mapk8). This protein has been shown to prevent MAPK8 mediated activation of transcription factors, and to decrease IL-1 beta and MAP kinase kinase 1 (MEKK1) induced apoptosis in pancreatic beta cells. This protein also functions as a DNA-binding transactivator of the glucose transporter GLUT2. RE1-silencing transcription factor (REST) is reported to repress the expression of this gene in insulin-secreting beta cells. This gene is found to be mutated in a type 2 diabetes family, and thus is thought to be a susceptibility gene for type 2 diabetes. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutation of this gene results in a decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Mapk8ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mapk8ip1 APN 2 92385188 missense probably benign 0.06
IGL01538:Mapk8ip1 APN 2 92388974 critical splice donor site probably null
IGL02089:Mapk8ip1 APN 2 92385875 missense probably damaging 1.00
IGL02177:Mapk8ip1 APN 2 92386747 missense probably damaging 1.00
IGL03032:Mapk8ip1 APN 2 92386613 missense probably damaging 1.00
IGL03180:Mapk8ip1 APN 2 92386912 missense possibly damaging 0.91
R0243:Mapk8ip1 UTSW 2 92385944 missense probably damaging 1.00
R0483:Mapk8ip1 UTSW 2 92385976 splice site probably null
R0515:Mapk8ip1 UTSW 2 92387356 missense possibly damaging 0.71
R2016:Mapk8ip1 UTSW 2 92391034 critical splice donor site probably null
R2017:Mapk8ip1 UTSW 2 92391034 critical splice donor site probably null
R5141:Mapk8ip1 UTSW 2 92386765 missense probably damaging 1.00
R5858:Mapk8ip1 UTSW 2 92384972 missense probably damaging 1.00
R6194:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6243:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6245:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6984:Mapk8ip1 UTSW 2 92386727 missense probably damaging 1.00
R7471:Mapk8ip1 UTSW 2 92389144 missense probably benign
X0023:Mapk8ip1 UTSW 2 92386601 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ATCCTTCCCTGCAGAAAGCC -3'
(R):5'- TGATTTCACTCTGGGCTCGG -3'

Sequencing Primer
(F):5'- TGCAGAAAGCCTGTCCCTC -3'
(R):5'- TTACAACCCGGGTGAGGTCAC -3'
Posted On2018-10-05