Incidental Mutation 'R6862:Pde4dip'
ID535676
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6862 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 97767024 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 192 (R192L)
Ref Sequence ENSEMBL: ENSMUSP00000134832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045243] [ENSMUST00000090750] [ENSMUST00000107038] [ENSMUST00000168438] [ENSMUST00000175751]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045243
AA Change: R192L

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040905
Gene: ENSMUSG00000038170
AA Change: R192L

DomainStartEndE-ValueType
low complexity region 72 90 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
SCOP:d1gw5a_ 613 839 3e-3 SMART
coiled coil region 909 985 N/A INTRINSIC
low complexity region 1081 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090750
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107038
SMART Domains Protein: ENSMUSP00000102653
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
Pfam:Microtub_assoc 70 144 7.8e-32 PFAM
low complexity region 150 165 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
internal_repeat_1 343 384 5.54e-5 PROSPERO
low complexity region 513 524 N/A INTRINSIC
internal_repeat_1 566 607 5.54e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168438
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175751
AA Change: R192L

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134832
Gene: ENSMUSG00000038170
AA Change: R192L

DomainStartEndE-ValueType
Pfam:zf-AD 4 78 4.3e-8 PFAM
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
coiled coil region 513 538 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,186,188 probably benign Het
Adgra2 C A 8: 27,113,436 H416Q probably benign Het
Adgra2 T A 8: 27,113,437 C417S probably damaging Het
Aff3 C A 1: 38,406,497 R307L possibly damaging Het
Arhgap17 T C 7: 123,321,901 D121G probably damaging Het
Ascc3 G T 10: 50,849,646 R2155I probably null Het
Ccdc115 C T 1: 34,439,283 S19N possibly damaging Het
Ccser2 T C 14: 36,940,081 N382S probably benign Het
Cct6b A T 11: 82,719,959 V500E probably damaging Het
Cenpo A T 12: 4,216,539 Y190N probably damaging Het
Cfh T A 1: 140,102,362 K924N probably damaging Het
Col4a1 A G 8: 11,202,926 probably benign Het
Coro1b T C 19: 4,150,771 V234A probably benign Het
Crot T C 5: 8,989,641 K69E probably damaging Het
Cyp2d11 A T 15: 82,390,138 H347Q probably benign Het
Fam71b G A 11: 46,407,591 G574D possibly damaging Het
Fbn2 T A 18: 58,124,321 I325F probably benign Het
Fbxw4 T A 19: 45,582,748 R41S probably benign Het
Fn1 T A 1: 71,613,907 I1308F probably benign Het
Frem1 C A 4: 83,012,014 E232* probably null Het
Gabrg3 T C 7: 56,773,311 Q213R possibly damaging Het
Gm11639 A T 11: 104,721,458 K636* probably null Het
Gm428 A G 4: 73,687,384 N344S probably benign Het
Gsdme A T 6: 50,227,398 V193E probably damaging Het
Hadha C A 5: 30,147,979 probably null Het
Hdgfl2 C A 17: 56,099,211 A533E probably damaging Het
Hivep2 T C 10: 14,130,583 F975S probably damaging Het
Htatip2 T A 7: 49,770,918 S171T probably benign Het
Ift57 A T 16: 49,763,804 I307F possibly damaging Het
Il22 A T 10: 118,205,810 R110W probably benign Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif2b G A 11: 91,575,915 T514M probably damaging Het
Kmt2c A C 5: 25,310,517 I2776S probably damaging Het
Ly9 T C 1: 171,601,155 D189G probably benign Het
Mal2 T C 15: 54,588,357 V58A probably damaging Het
Mettl21e T A 1: 44,206,366 N240I probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nacc1 G A 8: 84,673,215 R458C probably damaging Het
Ncapd3 T C 9: 27,030,809 C14R probably damaging Het
Obscn G T 11: 58,995,453 probably benign Het
Olfr273 A G 4: 52,855,695 F273L probably benign Het
Olfr350 A T 2: 36,850,222 M59L possibly damaging Het
Olfr930 T A 9: 38,930,476 F102I possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pdlim4 C A 11: 54,055,848 E204D probably damaging Het
Phf3 T C 1: 30,813,982 Q1049R probably damaging Het
Prr14l A G 5: 32,827,759 L1464P probably damaging Het
Psg25 C T 7: 18,521,398 V398I probably benign Het
Ptprq T A 10: 107,686,225 N622Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Tex36 A G 7: 133,587,273 L190P probably benign Het
Tk1 A G 11: 117,816,494 C156R probably damaging Het
Tmem144 T A 3: 79,832,099 M126L probably benign Het
Tmem208 G A 8: 105,328,230 probably null Het
Trappc13 T C 13: 104,150,152 Q199R probably damaging Het
Trim30b T A 7: 104,363,753 K156N probably damaging Het
Trps1 A G 15: 50,831,605 probably null Het
Washc4 T A 10: 83,558,893 F329Y possibly damaging Het
Zbed5 T G 5: 129,903,185 D658E probably benign Het
Zfyve28 T G 5: 34,288,105 K11N probably benign Het
Zp1 C T 19: 10,916,513 V443I possibly damaging Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7929:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCTGGACACTAGCATCC -3'
(R):5'- GGCTTGCCAGATATGAGGTAC -3'

Sequencing Primer
(F):5'- ATCCAGAGACTCCACGGAGG -3'
(R):5'- GCTGCTCCAAGAAGACTTTG -3'
Posted On2018-10-18