Incidental Mutation 'R6862:Hadha'
ID535683
Institutional Source Beutler Lab
Gene Symbol Hadha
Ensembl Gene ENSMUSG00000025745
Gene Namehydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit
SynonymsMtpa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6862 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30118304-30155162 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 30147979 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156859]
Predicted Effect probably null
Transcript: ENSMUST00000156859
SMART Domains Protein: ENSMUSP00000120976
Gene: ENSMUSG00000025745

DomainStartEndE-ValueType
Pfam:ECH_1 44 297 3.6e-42 PFAM
Pfam:ECH_2 49 225 8.6e-27 PFAM
Pfam:3HCDH_N 363 542 1e-54 PFAM
Pfam:3HCDH 544 639 7.7e-29 PFAM
low complexity region 706 720 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the alpha subunit catalyzing the 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities. Mutations in this gene result in trifunctional protein deficiency or LCHAD deficiency. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within 36 hours with hypoglycemia and liver steatosis. Liver steatosis and insulin resistance develop in heterozygotes with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,186,188 probably benign Het
Adgra2 C A 8: 27,113,436 H416Q probably benign Het
Adgra2 T A 8: 27,113,437 C417S probably damaging Het
Aff3 C A 1: 38,406,497 R307L possibly damaging Het
Arhgap17 T C 7: 123,321,901 D121G probably damaging Het
Ascc3 G T 10: 50,849,646 R2155I probably null Het
Ccdc115 C T 1: 34,439,283 S19N possibly damaging Het
Ccser2 T C 14: 36,940,081 N382S probably benign Het
Cct6b A T 11: 82,719,959 V500E probably damaging Het
Cenpo A T 12: 4,216,539 Y190N probably damaging Het
Cfh T A 1: 140,102,362 K924N probably damaging Het
Col4a1 A G 8: 11,202,926 probably benign Het
Coro1b T C 19: 4,150,771 V234A probably benign Het
Crot T C 5: 8,989,641 K69E probably damaging Het
Cyp2d11 A T 15: 82,390,138 H347Q probably benign Het
Fam71b G A 11: 46,407,591 G574D possibly damaging Het
Fbn2 T A 18: 58,124,321 I325F probably benign Het
Fbxw4 T A 19: 45,582,748 R41S probably benign Het
Fn1 T A 1: 71,613,907 I1308F probably benign Het
Frem1 C A 4: 83,012,014 E232* probably null Het
Gabrg3 T C 7: 56,773,311 Q213R possibly damaging Het
Gm11639 A T 11: 104,721,458 K636* probably null Het
Gm428 A G 4: 73,687,384 N344S probably benign Het
Gsdme A T 6: 50,227,398 V193E probably damaging Het
Hdgfl2 C A 17: 56,099,211 A533E probably damaging Het
Hivep2 T C 10: 14,130,583 F975S probably damaging Het
Htatip2 T A 7: 49,770,918 S171T probably benign Het
Ift57 A T 16: 49,763,804 I307F possibly damaging Het
Il22 A T 10: 118,205,810 R110W probably benign Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif2b G A 11: 91,575,915 T514M probably damaging Het
Kmt2c A C 5: 25,310,517 I2776S probably damaging Het
Ly9 T C 1: 171,601,155 D189G probably benign Het
Mal2 T C 15: 54,588,357 V58A probably damaging Het
Mettl21e T A 1: 44,206,366 N240I probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nacc1 G A 8: 84,673,215 R458C probably damaging Het
Ncapd3 T C 9: 27,030,809 C14R probably damaging Het
Obscn G T 11: 58,995,453 probably benign Het
Olfr273 A G 4: 52,855,695 F273L probably benign Het
Olfr350 A T 2: 36,850,222 M59L possibly damaging Het
Olfr930 T A 9: 38,930,476 F102I possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pde4dip C A 3: 97,767,024 R192L possibly damaging Het
Pdlim4 C A 11: 54,055,848 E204D probably damaging Het
Phf3 T C 1: 30,813,982 Q1049R probably damaging Het
Prr14l A G 5: 32,827,759 L1464P probably damaging Het
Psg25 C T 7: 18,521,398 V398I probably benign Het
Ptprq T A 10: 107,686,225 N622Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Tex36 A G 7: 133,587,273 L190P probably benign Het
Tk1 A G 11: 117,816,494 C156R probably damaging Het
Tmem144 T A 3: 79,832,099 M126L probably benign Het
Tmem208 G A 8: 105,328,230 probably null Het
Trappc13 T C 13: 104,150,152 Q199R probably damaging Het
Trim30b T A 7: 104,363,753 K156N probably damaging Het
Trps1 A G 15: 50,831,605 probably null Het
Washc4 T A 10: 83,558,893 F329Y possibly damaging Het
Zbed5 T G 5: 129,903,185 D658E probably benign Het
Zfyve28 T G 5: 34,288,105 K11N probably benign Het
Zp1 C T 19: 10,916,513 V443I possibly damaging Het
Other mutations in Hadha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Hadha APN 5 30120147 missense possibly damaging 0.94
IGL00435:Hadha APN 5 30122173 missense probably benign 0.12
IGL01413:Hadha APN 5 30141027 missense probably benign 0.01
IGL01715:Hadha APN 5 30120084 missense probably damaging 1.00
IGL02065:Hadha APN 5 30142845 splice site probably benign
IGL02316:Hadha APN 5 30126567 missense probably benign 0.04
IGL02366:Hadha APN 5 30135050 missense probably benign 0.01
IGL02453:Hadha APN 5 30144306 splice site probably benign
IGL02611:Hadha APN 5 30128943 splice site probably benign
IGL03127:Hadha APN 5 30134186 splice site probably benign
IGL03181:Hadha APN 5 30121526 missense probably benign 0.20
R1381:Hadha UTSW 5 30128836 missense probably benign
R1501:Hadha UTSW 5 30128806 missense probably benign 0.02
R2060:Hadha UTSW 5 30128836 missense probably benign 0.30
R3764:Hadha UTSW 5 30144209 missense probably damaging 1.00
R3778:Hadha UTSW 5 30120129 missense probably damaging 0.98
R5025:Hadha UTSW 5 30154961 unclassified probably benign
R5523:Hadha UTSW 5 30145254 missense possibly damaging 0.78
R5870:Hadha UTSW 5 30144286 missense possibly damaging 0.61
R6054:Hadha UTSW 5 30123684 missense probably benign 0.00
R6144:Hadha UTSW 5 30140996 missense probably benign 0.04
R6245:Hadha UTSW 5 30120044 critical splice donor site probably null
R6495:Hadha UTSW 5 30120050 missense probably benign 0.03
R7038:Hadha UTSW 5 30120000 intron probably null
R7200:Hadha UTSW 5 30145317 missense probably benign 0.25
R7215:Hadha UTSW 5 30119842 missense probably benign 0.00
R7267:Hadha UTSW 5 30122757 missense probably damaging 1.00
R7414:Hadha UTSW 5 30126612 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGCCACCCCATATTTAGAGATG -3'
(R):5'- GCTGTCTGGTTAATCATTTGACC -3'

Sequencing Primer
(F):5'- GCCACCCCATATTTAGAGATGAACAC -3'
(R):5'- GGATTAGAATACGTTGTTCTG -3'
Posted On2018-10-18