Incidental Mutation 'R6862:Zfyve28'
ID535685
Institutional Source Beutler Lab
Gene Symbol Zfyve28
Ensembl Gene ENSMUSG00000037224
Gene Namezinc finger, FYVE domain containing 28
Synonyms9630058O20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6862 (G1)
Quality Score157.009
Status Validated
Chromosome5
Chromosomal Location34194893-34288449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34288105 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 11 (K11N)
Ref Sequence ENSEMBL: ENSMUSP00000110008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094868] [ENSMUST00000114368] [ENSMUST00000207754]
Predicted Effect probably benign
Transcript: ENSMUST00000094868
AA Change: K11N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092464
Gene: ENSMUSG00000037224
AA Change: K11N

DomainStartEndE-ValueType
low complexity region 718 730 N/A INTRINSIC
FYVE 827 896 8.73e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114368
AA Change: K11N

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000207754
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,186,188 probably benign Het
Adgra2 C A 8: 27,113,436 H416Q probably benign Het
Adgra2 T A 8: 27,113,437 C417S probably damaging Het
Aff3 C A 1: 38,406,497 R307L possibly damaging Het
Arhgap17 T C 7: 123,321,901 D121G probably damaging Het
Ascc3 G T 10: 50,849,646 R2155I probably null Het
Ccdc115 C T 1: 34,439,283 S19N possibly damaging Het
Ccser2 T C 14: 36,940,081 N382S probably benign Het
Cct6b A T 11: 82,719,959 V500E probably damaging Het
Cenpo A T 12: 4,216,539 Y190N probably damaging Het
Cfh T A 1: 140,102,362 K924N probably damaging Het
Col4a1 A G 8: 11,202,926 probably benign Het
Coro1b T C 19: 4,150,771 V234A probably benign Het
Crot T C 5: 8,989,641 K69E probably damaging Het
Cyp2d11 A T 15: 82,390,138 H347Q probably benign Het
Fam71b G A 11: 46,407,591 G574D possibly damaging Het
Fbn2 T A 18: 58,124,321 I325F probably benign Het
Fbxw4 T A 19: 45,582,748 R41S probably benign Het
Fn1 T A 1: 71,613,907 I1308F probably benign Het
Frem1 C A 4: 83,012,014 E232* probably null Het
Gabrg3 T C 7: 56,773,311 Q213R possibly damaging Het
Gm11639 A T 11: 104,721,458 K636* probably null Het
Gm428 A G 4: 73,687,384 N344S probably benign Het
Gsdme A T 6: 50,227,398 V193E probably damaging Het
Hadha C A 5: 30,147,979 probably null Het
Hdgfl2 C A 17: 56,099,211 A533E probably damaging Het
Hivep2 T C 10: 14,130,583 F975S probably damaging Het
Htatip2 T A 7: 49,770,918 S171T probably benign Het
Ift57 A T 16: 49,763,804 I307F possibly damaging Het
Il22 A T 10: 118,205,810 R110W probably benign Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif2b G A 11: 91,575,915 T514M probably damaging Het
Kmt2c A C 5: 25,310,517 I2776S probably damaging Het
Ly9 T C 1: 171,601,155 D189G probably benign Het
Mal2 T C 15: 54,588,357 V58A probably damaging Het
Mettl21e T A 1: 44,206,366 N240I probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nacc1 G A 8: 84,673,215 R458C probably damaging Het
Ncapd3 T C 9: 27,030,809 C14R probably damaging Het
Obscn G T 11: 58,995,453 probably benign Het
Olfr273 A G 4: 52,855,695 F273L probably benign Het
Olfr350 A T 2: 36,850,222 M59L possibly damaging Het
Olfr930 T A 9: 38,930,476 F102I possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pde4dip C A 3: 97,767,024 R192L possibly damaging Het
Pdlim4 C A 11: 54,055,848 E204D probably damaging Het
Phf3 T C 1: 30,813,982 Q1049R probably damaging Het
Prr14l A G 5: 32,827,759 L1464P probably damaging Het
Psg25 C T 7: 18,521,398 V398I probably benign Het
Ptprq T A 10: 107,686,225 N622Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Tex36 A G 7: 133,587,273 L190P probably benign Het
Tk1 A G 11: 117,816,494 C156R probably damaging Het
Tmem144 T A 3: 79,832,099 M126L probably benign Het
Tmem208 G A 8: 105,328,230 probably null Het
Trappc13 T C 13: 104,150,152 Q199R probably damaging Het
Trim30b T A 7: 104,363,753 K156N probably damaging Het
Trps1 A G 15: 50,831,605 probably null Het
Washc4 T A 10: 83,558,893 F329Y possibly damaging Het
Zbed5 T G 5: 129,903,185 D658E probably benign Het
Zp1 C T 19: 10,916,513 V443I possibly damaging Het
Other mutations in Zfyve28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Zfyve28 APN 5 34243195 missense probably damaging 0.98
IGL02201:Zfyve28 APN 5 34243205 missense probably damaging 1.00
PIT4418001:Zfyve28 UTSW 5 34233377 missense probably damaging 1.00
R0499:Zfyve28 UTSW 5 34232206 missense possibly damaging 0.65
R1226:Zfyve28 UTSW 5 34217064 missense probably benign 0.00
R1290:Zfyve28 UTSW 5 34198801 missense probably benign 0.00
R1351:Zfyve28 UTSW 5 34232205 missense probably damaging 1.00
R1418:Zfyve28 UTSW 5 34217246 missense probably damaging 0.99
R2062:Zfyve28 UTSW 5 34234337 missense probably null 0.73
R2212:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R2443:Zfyve28 UTSW 5 34216894 missense possibly damaging 0.64
R2851:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R2852:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R3412:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R3413:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R3694:Zfyve28 UTSW 5 34217468 missense probably damaging 1.00
R4645:Zfyve28 UTSW 5 34222443 intron probably benign
R4700:Zfyve28 UTSW 5 34217845 missense probably damaging 1.00
R4938:Zfyve28 UTSW 5 34233354 missense probably damaging 0.99
R5384:Zfyve28 UTSW 5 34216967 missense probably damaging 1.00
R5908:Zfyve28 UTSW 5 34216870 missense possibly damaging 0.62
R5936:Zfyve28 UTSW 5 34224988 missense probably damaging 1.00
R6260:Zfyve28 UTSW 5 34198872 missense probably damaging 0.99
R7172:Zfyve28 UTSW 5 34234409 missense probably benign 0.42
R7243:Zfyve28 UTSW 5 34198875 missense probably damaging 1.00
R7366:Zfyve28 UTSW 5 34232227 missense probably damaging 1.00
R7598:Zfyve28 UTSW 5 34236117 missense probably damaging 1.00
R7654:Zfyve28 UTSW 5 34243195 missense probably damaging 1.00
R7752:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTACTGGAAAAGAGCAGTC -3'
(R):5'- ATCGCCTAGGCATCGTTTG -3'

Sequencing Primer
(F):5'- AATGCGCGCCAGGTACATG -3'
(R):5'- GCTCTTAAGCCGTGAAGCAC -3'
Posted On2018-10-18