Incidental Mutation 'R6862:Tex36'
ID535695
Institutional Source Beutler Lab
Gene Symbol Tex36
Ensembl Gene ENSMUSG00000030976
Gene Nametestis expressed 36
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6862 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location133587024-133602158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133587273 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 190 (L190P)
Ref Sequence ENSEMBL: ENSMUSP00000033275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033275]
Predicted Effect probably benign
Transcript: ENSMUST00000033275
AA Change: L190P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033275
Gene: ENSMUSG00000030976
AA Change: L190P

DomainStartEndE-ValueType
Pfam:HDNR 1 177 1.2e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,186,188 probably benign Het
Adgra2 C A 8: 27,113,436 H416Q probably benign Het
Adgra2 T A 8: 27,113,437 C417S probably damaging Het
Aff3 C A 1: 38,406,497 R307L possibly damaging Het
Arhgap17 T C 7: 123,321,901 D121G probably damaging Het
Ascc3 G T 10: 50,849,646 R2155I probably null Het
Ccdc115 C T 1: 34,439,283 S19N possibly damaging Het
Ccser2 T C 14: 36,940,081 N382S probably benign Het
Cct6b A T 11: 82,719,959 V500E probably damaging Het
Cenpo A T 12: 4,216,539 Y190N probably damaging Het
Cfh T A 1: 140,102,362 K924N probably damaging Het
Col4a1 A G 8: 11,202,926 probably benign Het
Coro1b T C 19: 4,150,771 V234A probably benign Het
Crot T C 5: 8,989,641 K69E probably damaging Het
Cyp2d11 A T 15: 82,390,138 H347Q probably benign Het
Fam71b G A 11: 46,407,591 G574D possibly damaging Het
Fbn2 T A 18: 58,124,321 I325F probably benign Het
Fbxw4 T A 19: 45,582,748 R41S probably benign Het
Fn1 T A 1: 71,613,907 I1308F probably benign Het
Frem1 C A 4: 83,012,014 E232* probably null Het
Gabrg3 T C 7: 56,773,311 Q213R possibly damaging Het
Gm11639 A T 11: 104,721,458 K636* probably null Het
Gm428 A G 4: 73,687,384 N344S probably benign Het
Gsdme A T 6: 50,227,398 V193E probably damaging Het
Hadha C A 5: 30,147,979 probably null Het
Hdgfl2 C A 17: 56,099,211 A533E probably damaging Het
Hivep2 T C 10: 14,130,583 F975S probably damaging Het
Htatip2 T A 7: 49,770,918 S171T probably benign Het
Ift57 A T 16: 49,763,804 I307F possibly damaging Het
Il22 A T 10: 118,205,810 R110W probably benign Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif2b G A 11: 91,575,915 T514M probably damaging Het
Kmt2c A C 5: 25,310,517 I2776S probably damaging Het
Ly9 T C 1: 171,601,155 D189G probably benign Het
Mal2 T C 15: 54,588,357 V58A probably damaging Het
Mettl21e T A 1: 44,206,366 N240I probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nacc1 G A 8: 84,673,215 R458C probably damaging Het
Ncapd3 T C 9: 27,030,809 C14R probably damaging Het
Obscn G T 11: 58,995,453 probably benign Het
Olfr273 A G 4: 52,855,695 F273L probably benign Het
Olfr350 A T 2: 36,850,222 M59L possibly damaging Het
Olfr930 T A 9: 38,930,476 F102I possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pde4dip C A 3: 97,767,024 R192L possibly damaging Het
Pdlim4 C A 11: 54,055,848 E204D probably damaging Het
Phf3 T C 1: 30,813,982 Q1049R probably damaging Het
Prr14l A G 5: 32,827,759 L1464P probably damaging Het
Psg25 C T 7: 18,521,398 V398I probably benign Het
Ptprq T A 10: 107,686,225 N622Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Tk1 A G 11: 117,816,494 C156R probably damaging Het
Tmem144 T A 3: 79,832,099 M126L probably benign Het
Tmem208 G A 8: 105,328,230 probably null Het
Trappc13 T C 13: 104,150,152 Q199R probably damaging Het
Trim30b T A 7: 104,363,753 K156N probably damaging Het
Trps1 A G 15: 50,831,605 probably null Het
Washc4 T A 10: 83,558,893 F329Y possibly damaging Het
Zbed5 T G 5: 129,903,185 D658E probably benign Het
Zfyve28 T G 5: 34,288,105 K11N probably benign Het
Zp1 C T 19: 10,916,513 V443I possibly damaging Het
Other mutations in Tex36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02412:Tex36 APN 7 133587408 missense probably benign 0.27
R1421:Tex36 UTSW 7 133595349 splice site probably null
R2061:Tex36 UTSW 7 133595223 missense probably damaging 1.00
R4580:Tex36 UTSW 7 133587382 missense possibly damaging 0.47
R4905:Tex36 UTSW 7 133587453 missense probably damaging 1.00
R5023:Tex36 UTSW 7 133595290 missense probably benign 0.00
R5532:Tex36 UTSW 7 133601983 missense probably benign 0.02
R6306:Tex36 UTSW 7 133595325 missense probably benign
R6658:Tex36 UTSW 7 133594411 missense probably damaging 1.00
R7215:Tex36 UTSW 7 133587418 nonsense probably null
R7291:Tex36 UTSW 7 133587223 missense probably benign
R7428:Tex36 UTSW 7 133595137 intron probably null
Predicted Primers PCR Primer
(F):5'- CCCCAAAGGTTAACATGACAATCTTAG -3'
(R):5'- ACATCCCATCCAATTTTGATGGTC -3'

Sequencing Primer
(F):5'- GCAGTTAATTTACACATGCAATAGC -3'
(R):5'- TCCTACGTACCTAAGAAAGCTGTGG -3'
Posted On2018-10-18