Incidental Mutation 'R6862:Fam71b'
ID535709
Institutional Source Beutler Lab
Gene Symbol Fam71b
Ensembl Gene ENSMUSG00000020401
Gene Namefamily with sequence similarity 71, member B
SynonymsOTTMUSG00000005491
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6862 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46396559-46407982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46407591 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 574 (G574D)
Ref Sequence ENSEMBL: ENSMUSP00000055079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063166
AA Change: G574D

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055079
Gene: ENSMUSG00000020401
AA Change: G574D

DomainStartEndE-ValueType
Pfam:DUF3699 120 192 1.2e-32 PFAM
low complexity region 241 361 N/A INTRINSIC
low complexity region 497 523 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
SCOP:d1g7sa3 586 650 1e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,186,188 probably benign Het
Adgra2 C A 8: 27,113,436 H416Q probably benign Het
Adgra2 T A 8: 27,113,437 C417S probably damaging Het
Aff3 C A 1: 38,406,497 R307L possibly damaging Het
Arhgap17 T C 7: 123,321,901 D121G probably damaging Het
Ascc3 G T 10: 50,849,646 R2155I probably null Het
Ccdc115 C T 1: 34,439,283 S19N possibly damaging Het
Ccser2 T C 14: 36,940,081 N382S probably benign Het
Cct6b A T 11: 82,719,959 V500E probably damaging Het
Cenpo A T 12: 4,216,539 Y190N probably damaging Het
Cfh T A 1: 140,102,362 K924N probably damaging Het
Col4a1 A G 8: 11,202,926 probably benign Het
Coro1b T C 19: 4,150,771 V234A probably benign Het
Crot T C 5: 8,989,641 K69E probably damaging Het
Cyp2d11 A T 15: 82,390,138 H347Q probably benign Het
Fbn2 T A 18: 58,124,321 I325F probably benign Het
Fbxw4 T A 19: 45,582,748 R41S probably benign Het
Fn1 T A 1: 71,613,907 I1308F probably benign Het
Frem1 C A 4: 83,012,014 E232* probably null Het
Gabrg3 T C 7: 56,773,311 Q213R possibly damaging Het
Gm11639 A T 11: 104,721,458 K636* probably null Het
Gm428 A G 4: 73,687,384 N344S probably benign Het
Gsdme A T 6: 50,227,398 V193E probably damaging Het
Hadha C A 5: 30,147,979 probably null Het
Hdgfl2 C A 17: 56,099,211 A533E probably damaging Het
Hivep2 T C 10: 14,130,583 F975S probably damaging Het
Htatip2 T A 7: 49,770,918 S171T probably benign Het
Ift57 A T 16: 49,763,804 I307F possibly damaging Het
Il22 A T 10: 118,205,810 R110W probably benign Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif2b G A 11: 91,575,915 T514M probably damaging Het
Kmt2c A C 5: 25,310,517 I2776S probably damaging Het
Ly9 T C 1: 171,601,155 D189G probably benign Het
Mal2 T C 15: 54,588,357 V58A probably damaging Het
Mettl21e T A 1: 44,206,366 N240I probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nacc1 G A 8: 84,673,215 R458C probably damaging Het
Ncapd3 T C 9: 27,030,809 C14R probably damaging Het
Obscn G T 11: 58,995,453 probably benign Het
Olfr273 A G 4: 52,855,695 F273L probably benign Het
Olfr350 A T 2: 36,850,222 M59L possibly damaging Het
Olfr930 T A 9: 38,930,476 F102I possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pde4dip C A 3: 97,767,024 R192L possibly damaging Het
Pdlim4 C A 11: 54,055,848 E204D probably damaging Het
Phf3 T C 1: 30,813,982 Q1049R probably damaging Het
Prr14l A G 5: 32,827,759 L1464P probably damaging Het
Psg25 C T 7: 18,521,398 V398I probably benign Het
Ptprq T A 10: 107,686,225 N622Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Tex36 A G 7: 133,587,273 L190P probably benign Het
Tk1 A G 11: 117,816,494 C156R probably damaging Het
Tmem144 T A 3: 79,832,099 M126L probably benign Het
Tmem208 G A 8: 105,328,230 probably null Het
Trappc13 T C 13: 104,150,152 Q199R probably damaging Het
Trim30b T A 7: 104,363,753 K156N probably damaging Het
Trps1 A G 15: 50,831,605 probably null Het
Washc4 T A 10: 83,558,893 F329Y possibly damaging Het
Zbed5 T G 5: 129,903,185 D658E probably benign Het
Zfyve28 T G 5: 34,288,105 K11N probably benign Het
Zp1 C T 19: 10,916,513 V443I possibly damaging Het
Other mutations in Fam71b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Fam71b APN 11 46405397 nonsense probably null
IGL02375:Fam71b APN 11 46406552 missense probably damaging 0.99
IGL02571:Fam71b APN 11 46405245 missense probably damaging 0.99
R0013:Fam71b UTSW 11 46406804 missense unknown
R1902:Fam71b UTSW 11 46407011 missense probably benign 0.44
R1985:Fam71b UTSW 11 46407866 makesense probably null
R2079:Fam71b UTSW 11 46405107 missense probably benign 0.14
R2151:Fam71b UTSW 11 46405331 nonsense probably null
R2857:Fam71b UTSW 11 46405212 missense probably damaging 1.00
R2859:Fam71b UTSW 11 46405212 missense probably damaging 1.00
R3807:Fam71b UTSW 11 46404953 missense possibly damaging 0.77
R4232:Fam71b UTSW 11 46407405 missense possibly damaging 0.51
R4342:Fam71b UTSW 11 46407216 missense possibly damaging 0.67
R4679:Fam71b UTSW 11 46404813 missense possibly damaging 0.68
R5119:Fam71b UTSW 11 46407036 missense probably damaging 1.00
R5207:Fam71b UTSW 11 46405163 missense probably benign 0.13
R5540:Fam71b UTSW 11 46404888 missense probably damaging 0.99
R6618:Fam71b UTSW 11 46407299 missense probably damaging 1.00
R7036:Fam71b UTSW 11 46407408 missense
R7489:Fam71b UTSW 11 46407441 missense
R7809:Fam71b UTSW 11 46407804 missense
R7822:Fam71b UTSW 11 46404903 missense
Z1088:Fam71b UTSW 11 46407723 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAGCCAGAAGGTTTCCCAAAC -3'
(R):5'- ATCACGGCCTCTATGTCCTG -3'

Sequencing Primer
(F):5'- GGTTTCCCAAACTAGCTCTGAAG -3'
(R):5'- ATGTCCTGCTTCTTCTCTACCAAC -3'
Posted On2018-10-18