Incidental Mutation 'R6862:Cct6b'
ID535712
Institutional Source Beutler Lab
Gene Symbol Cct6b
Ensembl Gene ENSMUSG00000020698
Gene Namechaperonin containing Tcp1, subunit 6b (zeta)
SynonymsCCTzeta-2, Cctz-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R6862 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82719250-82764321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82719959 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 500 (V500E)
Ref Sequence ENSEMBL: ENSMUSP00000021040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021040] [ENSMUST00000100722]
Predicted Effect probably damaging
Transcript: ENSMUST00000021040
AA Change: V500E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021040
Gene: ENSMUSG00000020698
AA Change: V500E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 30 526 1.1e-161 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100722
AA Change: V461E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098288
Gene: ENSMUSG00000020698
AA Change: V461E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 4 486 9.7e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin-containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,186,188 probably benign Het
Adgra2 C A 8: 27,113,436 H416Q probably benign Het
Adgra2 T A 8: 27,113,437 C417S probably damaging Het
Aff3 C A 1: 38,406,497 R307L possibly damaging Het
Arhgap17 T C 7: 123,321,901 D121G probably damaging Het
Ascc3 G T 10: 50,849,646 R2155I probably null Het
Ccdc115 C T 1: 34,439,283 S19N possibly damaging Het
Ccser2 T C 14: 36,940,081 N382S probably benign Het
Cenpo A T 12: 4,216,539 Y190N probably damaging Het
Cfh T A 1: 140,102,362 K924N probably damaging Het
Col4a1 A G 8: 11,202,926 probably benign Het
Coro1b T C 19: 4,150,771 V234A probably benign Het
Crot T C 5: 8,989,641 K69E probably damaging Het
Cyp2d11 A T 15: 82,390,138 H347Q probably benign Het
Fam71b G A 11: 46,407,591 G574D possibly damaging Het
Fbn2 T A 18: 58,124,321 I325F probably benign Het
Fbxw4 T A 19: 45,582,748 R41S probably benign Het
Fn1 T A 1: 71,613,907 I1308F probably benign Het
Frem1 C A 4: 83,012,014 E232* probably null Het
Gabrg3 T C 7: 56,773,311 Q213R possibly damaging Het
Gm11639 A T 11: 104,721,458 K636* probably null Het
Gm428 A G 4: 73,687,384 N344S probably benign Het
Gsdme A T 6: 50,227,398 V193E probably damaging Het
Hadha C A 5: 30,147,979 probably null Het
Hdgfl2 C A 17: 56,099,211 A533E probably damaging Het
Hivep2 T C 10: 14,130,583 F975S probably damaging Het
Htatip2 T A 7: 49,770,918 S171T probably benign Het
Ift57 A T 16: 49,763,804 I307F possibly damaging Het
Il22 A T 10: 118,205,810 R110W probably benign Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif2b G A 11: 91,575,915 T514M probably damaging Het
Kmt2c A C 5: 25,310,517 I2776S probably damaging Het
Ly9 T C 1: 171,601,155 D189G probably benign Het
Mal2 T C 15: 54,588,357 V58A probably damaging Het
Mettl21e T A 1: 44,206,366 N240I probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nacc1 G A 8: 84,673,215 R458C probably damaging Het
Ncapd3 T C 9: 27,030,809 C14R probably damaging Het
Obscn G T 11: 58,995,453 probably benign Het
Olfr273 A G 4: 52,855,695 F273L probably benign Het
Olfr350 A T 2: 36,850,222 M59L possibly damaging Het
Olfr930 T A 9: 38,930,476 F102I possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pde4dip C A 3: 97,767,024 R192L possibly damaging Het
Pdlim4 C A 11: 54,055,848 E204D probably damaging Het
Phf3 T C 1: 30,813,982 Q1049R probably damaging Het
Prr14l A G 5: 32,827,759 L1464P probably damaging Het
Psg25 C T 7: 18,521,398 V398I probably benign Het
Ptprq T A 10: 107,686,225 N622Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Tex36 A G 7: 133,587,273 L190P probably benign Het
Tk1 A G 11: 117,816,494 C156R probably damaging Het
Tmem144 T A 3: 79,832,099 M126L probably benign Het
Tmem208 G A 8: 105,328,230 probably null Het
Trappc13 T C 13: 104,150,152 Q199R probably damaging Het
Trim30b T A 7: 104,363,753 K156N probably damaging Het
Trps1 A G 15: 50,831,605 probably null Het
Washc4 T A 10: 83,558,893 F329Y possibly damaging Het
Zbed5 T G 5: 129,903,185 D658E probably benign Het
Zfyve28 T G 5: 34,288,105 K11N probably benign Het
Zp1 C T 19: 10,916,513 V443I possibly damaging Het
Other mutations in Cct6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Cct6b APN 11 82741391 missense probably damaging 1.00
IGL02606:Cct6b APN 11 82736445 missense probably damaging 1.00
IGL02707:Cct6b APN 11 82754954 splice site probably benign
IGL03081:Cct6b APN 11 82764169 nonsense probably null
R0032:Cct6b UTSW 11 82753643 missense possibly damaging 0.87
R0395:Cct6b UTSW 11 82739680 missense probably benign
R0556:Cct6b UTSW 11 82719444 splice site probably benign
R0631:Cct6b UTSW 11 82737088 splice site probably null
R1456:Cct6b UTSW 11 82753620 splice site probably benign
R3713:Cct6b UTSW 11 82760357 missense probably damaging 1.00
R4791:Cct6b UTSW 11 82742004 splice site probably null
R5154:Cct6b UTSW 11 82739695 missense probably damaging 1.00
R5256:Cct6b UTSW 11 82764220 missense probably damaging 0.98
R5338:Cct6b UTSW 11 82762189 missense possibly damaging 0.94
R5455:Cct6b UTSW 11 82755117 missense probably benign 0.04
R5560:Cct6b UTSW 11 82741413 missense probably damaging 1.00
R5616:Cct6b UTSW 11 82741349 missense probably damaging 1.00
R5644:Cct6b UTSW 11 82722455 missense probably benign 0.02
X0060:Cct6b UTSW 11 82741310 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCTGCTGCAAACACAATG -3'
(R):5'- AAGAGCCTTGGACTGCGAAG -3'

Sequencing Primer
(F):5'- CTGCTGCAAACACAATGTGAAG -3'
(R):5'- CTTGGACTGCGAAGGTGCTC -3'
Posted On2018-10-18