Incidental Mutation 'R6862:Kif2b'
ID 535713
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Name kinesin family member 2B
Synonyms 1700063D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock # R6862 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 91575315-91577558 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 91575915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 514 (T514M)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
AlphaFold Q8C0N1
Predicted Effect probably damaging
Transcript: ENSMUST00000061019
AA Change: T514M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: T514M

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,186,188 probably benign Het
Adgra2 C A 8: 27,113,436 H416Q probably benign Het
Adgra2 T A 8: 27,113,437 C417S probably damaging Het
Aff3 C A 1: 38,406,497 R307L possibly damaging Het
Arhgap17 T C 7: 123,321,901 D121G probably damaging Het
Ascc3 G T 10: 50,849,646 R2155I probably null Het
Ccdc115 C T 1: 34,439,283 S19N possibly damaging Het
Ccser2 T C 14: 36,940,081 N382S probably benign Het
Cct6b A T 11: 82,719,959 V500E probably damaging Het
Cenpo A T 12: 4,216,539 Y190N probably damaging Het
Cfh T A 1: 140,102,362 K924N probably damaging Het
Col4a1 A G 8: 11,202,926 probably benign Het
Coro1b T C 19: 4,150,771 V234A probably benign Het
Crot T C 5: 8,989,641 K69E probably damaging Het
Cyp2d11 A T 15: 82,390,138 H347Q probably benign Het
Fam71b G A 11: 46,407,591 G574D possibly damaging Het
Fbn2 T A 18: 58,124,321 I325F probably benign Het
Fbxw4 T A 19: 45,582,748 R41S probably benign Het
Fn1 T A 1: 71,613,907 I1308F probably benign Het
Frem1 C A 4: 83,012,014 E232* probably null Het
Gabrg3 T C 7: 56,773,311 Q213R possibly damaging Het
Gm11639 A T 11: 104,721,458 K636* probably null Het
Gm428 A G 4: 73,687,384 N344S probably benign Het
Gsdme A T 6: 50,227,398 V193E probably damaging Het
Hadha C A 5: 30,147,979 probably null Het
Hdgfl2 C A 17: 56,099,211 A533E probably damaging Het
Hivep2 T C 10: 14,130,583 F975S probably damaging Het
Htatip2 T A 7: 49,770,918 S171T probably benign Het
Ift57 A T 16: 49,763,804 I307F possibly damaging Het
Il22 A T 10: 118,205,810 R110W probably benign Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kmt2c A C 5: 25,310,517 I2776S probably damaging Het
Ly9 T C 1: 171,601,155 D189G probably benign Het
Mal2 T C 15: 54,588,357 V58A probably damaging Het
Mettl21e T A 1: 44,206,366 N240I probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nacc1 G A 8: 84,673,215 R458C probably damaging Het
Ncapd3 T C 9: 27,030,809 C14R probably damaging Het
Obscn G T 11: 58,995,453 probably benign Het
Olfr273 A G 4: 52,855,695 F273L probably benign Het
Olfr350 A T 2: 36,850,222 M59L possibly damaging Het
Olfr930 T A 9: 38,930,476 F102I possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pde4dip C A 3: 97,767,024 R192L possibly damaging Het
Pdlim4 C A 11: 54,055,848 E204D probably damaging Het
Phf3 T C 1: 30,813,982 Q1049R probably damaging Het
Prr14l A G 5: 32,827,759 L1464P probably damaging Het
Psg25 C T 7: 18,521,398 V398I probably benign Het
Ptprq T A 10: 107,686,225 N622Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Tex36 A G 7: 133,587,273 L190P probably benign Het
Tk1 A G 11: 117,816,494 C156R probably damaging Het
Tmem144 T A 3: 79,832,099 M126L probably benign Het
Tmem208 G A 8: 105,328,230 probably null Het
Trappc13 T C 13: 104,150,152 Q199R probably damaging Het
Trim30b T A 7: 104,363,753 K156N probably damaging Het
Trps1 A G 15: 50,831,605 probably null Het
Washc4 T A 10: 83,558,893 F329Y possibly damaging Het
Zbed5 T G 5: 129,903,185 D658E probably benign Het
Zfyve28 T G 5: 34,288,105 K11N probably benign Het
Zp1 C T 19: 10,916,513 V443I possibly damaging Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91576380 missense probably damaging 1.00
IGL01459:Kif2b APN 11 91577023 missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91576365 missense probably damaging 1.00
IGL02897:Kif2b APN 11 91576219 missense probably damaging 1.00
R0076:Kif2b UTSW 11 91575909 missense probably damaging 1.00
R0488:Kif2b UTSW 11 91576972 missense probably benign 0.00
R0524:Kif2b UTSW 11 91575724 missense probably benign 0.00
R0549:Kif2b UTSW 11 91576584 missense probably damaging 1.00
R0893:Kif2b UTSW 11 91575594 missense probably benign 0.16
R1677:Kif2b UTSW 11 91575972 missense probably damaging 1.00
R2025:Kif2b UTSW 11 91577346 missense probably damaging 0.99
R2185:Kif2b UTSW 11 91576971 frame shift probably null
R2290:Kif2b UTSW 11 91575696 missense probably benign 0.00
R4697:Kif2b UTSW 11 91576846 missense probably benign 0.01
R4785:Kif2b UTSW 11 91576428 missense probably benign 0.07
R5429:Kif2b UTSW 11 91577229 missense probably benign 0.03
R5555:Kif2b UTSW 11 91575460 missense probably benign 0.00
R5652:Kif2b UTSW 11 91575830 missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91577242 missense probably benign 0.28
R6101:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6105:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6450:Kif2b UTSW 11 91576366 missense probably damaging 0.99
R7097:Kif2b UTSW 11 91576824 missense probably benign 0.00
R7189:Kif2b UTSW 11 91577137 missense probably benign 0.01
R7507:Kif2b UTSW 11 91577443 missense probably benign
R7742:Kif2b UTSW 11 91576585 missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91576126 missense probably damaging 1.00
R7820:Kif2b UTSW 11 91577274 missense probably benign 0.01
R7946:Kif2b UTSW 11 91575745 missense probably benign 0.00
R8378:Kif2b UTSW 11 91576375 missense possibly damaging 0.95
R8442:Kif2b UTSW 11 91576314 missense possibly damaging 0.54
R8925:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8927:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8969:Kif2b UTSW 11 91577193 missense probably benign 0.00
R9002:Kif2b UTSW 11 91576227 missense probably benign 0.30
R9028:Kif2b UTSW 11 91577185 missense probably benign
R9039:Kif2b UTSW 11 91576305 missense possibly damaging 0.91
R9063:Kif2b UTSW 11 91575828 missense probably damaging 1.00
R9114:Kif2b UTSW 11 91575712 missense possibly damaging 0.77
R9279:Kif2b UTSW 11 91577149 missense probably benign 0.01
Z1176:Kif2b UTSW 11 91576264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTTTCCCGAATTCGTATTGTCG -3'
(R):5'- GCAAGTTTTCCCTGGTTGAC -3'

Sequencing Primer
(F):5'- GTCGTTTTCTATCATCAGTGGTAC -3'
(R):5'- CCTGGTTGACTTAGCTGGGAAC -3'
Posted On 2018-10-18