Incidental Mutation 'R6863:Agap3'
ID535740
Institutional Source Beutler Lab
Gene Symbol Agap3
Ensembl Gene ENSMUSG00000023353
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 3
SynonymsCrag, Centg3, MRIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R6863 (G1)
Quality Score211.009
Status Validated
Chromosome5
Chromosomal Location24452177-24502047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24452463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 86 (Y86F)
Ref Sequence ENSEMBL: ENSMUSP00000024123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024123] [ENSMUST00000030799] [ENSMUST00000115033] [ENSMUST00000123167] [ENSMUST00000127194] [ENSMUST00000212381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024123
AA Change: Y86F

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024123
Gene: ENSMUSG00000023353
AA Change: Y86F

DomainStartEndE-ValueType
low complexity region 4 59 N/A INTRINSIC
Pfam:Ras 128 286 1.2e-18 PFAM
low complexity region 328 345 N/A INTRINSIC
PH 403 642 2.76e-16 SMART
ArfGap 661 781 9.17e-51 SMART
ANK 820 849 2.43e1 SMART
ANK 853 885 9.17e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030799
SMART Domains Protein: ENSMUSP00000030799
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115033
SMART Domains Protein: ENSMUSP00000110685
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123167
SMART Domains Protein: ENSMUSP00000122487
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
Blast:UBQ 102 122 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127194
SMART Domains Protein: ENSMUSP00000123173
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
low complexity region 175 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212381
AA Change: Y86F

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in Agap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Agap3 APN 5 24498109 missense probably damaging 0.99
IGL00900:Agap3 APN 5 24476368 splice site probably benign
IGL00966:Agap3 APN 5 24501002 splice site probably benign
IGL02207:Agap3 APN 5 24499936 missense probably benign
IGL02431:Agap3 APN 5 24501012 missense probably damaging 1.00
IGL02601:Agap3 APN 5 24483371 missense possibly damaging 0.67
IGL03090:Agap3 APN 5 24501206 missense possibly damaging 0.91
IGL03131:Agap3 APN 5 24477132 missense probably benign 0.16
IGL03247:Agap3 APN 5 24487822 missense probably damaging 1.00
R0165:Agap3 UTSW 5 24479745 missense probably damaging 0.98
R0344:Agap3 UTSW 5 24451202 unclassified probably benign
R0496:Agap3 UTSW 5 24501243 missense probably damaging 1.00
R0542:Agap3 UTSW 5 24500186 missense possibly damaging 0.95
R1427:Agap3 UTSW 5 24476693 missense probably benign 0.03
R1840:Agap3 UTSW 5 24500231 missense probably damaging 1.00
R1903:Agap3 UTSW 5 24493013 missense probably damaging 1.00
R2101:Agap3 UTSW 5 24487799 missense probably damaging 1.00
R4601:Agap3 UTSW 5 24476408 missense probably damaging 1.00
R4745:Agap3 UTSW 5 24451125 unclassified probably null
R4807:Agap3 UTSW 5 24477116 missense probably damaging 1.00
R4808:Agap3 UTSW 5 24501245 missense probably benign
R4916:Agap3 UTSW 5 24478013 missense probably damaging 0.98
R5056:Agap3 UTSW 5 24477862 missense probably damaging 1.00
R5094:Agap3 UTSW 5 24451321 unclassified probably benign
R5646:Agap3 UTSW 5 24483397 missense probably benign 0.01
R5937:Agap3 UTSW 5 24477817 missense probably damaging 0.99
R6365:Agap3 UTSW 5 24474985 missense probably benign 0.43
R6798:Agap3 UTSW 5 24498282 intron probably null
R6802:Agap3 UTSW 5 24487793 missense possibly damaging 0.87
R6863:Agap3 UTSW 5 24452464 nonsense probably null
R7039:Agap3 UTSW 5 24483401 missense probably benign 0.01
R7111:Agap3 UTSW 5 24501398 missense probably damaging 1.00
R7313:Agap3 UTSW 5 24452384 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGCCATGAACTTCCAGGCAG -3'
(R):5'- AGCTCCATAAGACCCCTGAG -3'

Sequencing Primer
(F):5'- AGAGTCCTCAGCAGCAGCAG -3'
(R):5'- TAAGACCCCTGAGCGCCAG -3'
Posted On2018-10-18