Incidental Mutation 'R6863:Tnrc18'
ID535744
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Nametrinucleotide repeat containing 18
SynonymsZfp469, EG381742
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R6863 (G1)
Quality Score125.008
Status Validated
Chromosome5
Chromosomal Location142724661-142817662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142815197 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000114769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000198181]
Predicted Effect probably damaging
Transcript: ENSMUST00000151477
AA Change: D2G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: D2G

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198181
AA Change: D2G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143178
Gene: ENSMUSG00000039477
AA Change: D2G

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142776324 missense unknown
R1931:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142765173 missense unknown
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6711:Tnrc18 UTSW 5 142787790 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7135:Tnrc18 UTSW 5 142787817 missense
Predicted Primers PCR Primer
(F):5'- ATCCCCATCAAAGCTGGAGG -3'
(R):5'- AGATACCGTGTACGCCTCCTTC -3'

Sequencing Primer
(F):5'- AACACTTACCCGGGTGCG -3'
(R):5'- TCATCTCCGCTCAGCCG -3'
Posted On2018-10-18