Incidental Mutation 'R6863:Pik3r2'
ID535754
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Namephosphoinositide-3-kinase regulatory subunit 2
Synonymsp85beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6863 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70768176-70776713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70770414 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 454 (Y454C)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
PDB Structure
CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034296
AA Change: Y454C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: Y454C

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Meta Mutation Damage Score 0.5198 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 70770429 missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 70772348 unclassified probably benign
IGL02514:Pik3r2 APN 8 70770592 missense probably benign 0.00
IGL03395:Pik3r2 APN 8 70772355 missense probably benign
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 70772044 unclassified probably benign
R1636:Pik3r2 UTSW 8 70771898 missense probably benign
R1662:Pik3r2 UTSW 8 70770606 missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 70769385 missense probably benign 0.31
R2879:Pik3r2 UTSW 8 70772385 missense probably benign
R3830:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3852:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3859:Pik3r2 UTSW 8 70769986 missense probably damaging 1.00
R3967:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3968:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3969:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3970:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R4606:Pik3r2 UTSW 8 70772136 nonsense probably null
R4666:Pik3r2 UTSW 8 70768859 missense possibly damaging 0.93
R5481:Pik3r2 UTSW 8 70769764 missense probably benign 0.31
R6445:Pik3r2 UTSW 8 70772026 missense probably benign 0.01
R6578:Pik3r2 UTSW 8 70772639 missense probably benign 0.00
R6667:Pik3r2 UTSW 8 70769173 missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 70770717 missense probably benign 0.43
R7378:Pik3r2 UTSW 8 70769381 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAATAGTGCTGGCTGGCTG -3'
(R):5'- ACCAACAAGTGTGTGCTGC -3'

Sequencing Primer
(F):5'- TGGCTGGCTGCACTCAG -3'
(R):5'- CAAGTGTGTGCTGCGCTGG -3'
Posted On2018-10-18