Incidental Mutation 'R6863:Wdr35'
ID535772
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6863 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8990047 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 384 (D384G)
Ref Sequence ENSEMBL: ENSMUSP00000106742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000160329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085745
AA Change: D384G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: D384G

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111113
AA Change: D384G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: D384G

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160329
SMART Domains Protein: ENSMUSP00000124285
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
low complexity region 172 186 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCCTGATAACCGCAACTGTTAC -3'
(R):5'- ATCCAGGAGAGCCAATGTTC -3'

Sequencing Primer
(F):5'- ACCGCAACTGTTACACTATTTTG -3'
(R):5'- AGGAGAGCCAATGTTCTGTCC -3'
Posted On2018-10-18