Incidental Mutation 'R6863:Cacna1d'
ID535778
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R6863 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30075852 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 1426 (I1426S)
Ref Sequence ENSEMBL: ENSMUSP00000153293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
Predicted Effect probably damaging
Transcript: ENSMUST00000112249
AA Change: I1426S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: I1426S

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112250
AA Change: I1448S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: I1448S

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000223803
AA Change: I1426S

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000224198
AA Change: I1461S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: I1426S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000224912
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
Brisk UTSW 14 30171314 missense possibly damaging 0.91
Troppo UTSW 14 30123454 missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 30178645 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
R7066:Cacna1d UTSW 14 30352978 intron probably benign
R7188:Cacna1d UTSW 14 30089833 missense probably benign
R7242:Cacna1d UTSW 14 30178706 missense probably benign 0.00
R7249:Cacna1d UTSW 14 30142703 missense probably damaging 1.00
R7250:Cacna1d UTSW 14 30075151 missense probably damaging 1.00
R7274:Cacna1d UTSW 14 30142643 missense probably damaging 1.00
R7336:Cacna1d UTSW 14 30045282 missense probably benign 0.18
R7343:Cacna1d UTSW 14 30123057 missense probably benign 0.02
R7411:Cacna1d UTSW 14 30352990 start codon destroyed probably null
R7461:Cacna1d UTSW 14 30066163 missense probably benign 0.05
R7534:Cacna1d UTSW 14 30079362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACACCTGCCTAGAAGGG -3'
(R):5'- ACGGCATTGCTACAGTTACATAC -3'

Sequencing Primer
(F):5'- GCCCAGAGTATGCCAACTG -3'
(R):5'- GCACAAGCTAAGAATTTTCTTCCC -3'
Posted On2018-10-18