Incidental Mutation 'R6863:Adamts20'
ID535781
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
MMRRC Submission
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6863 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 94379746 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 278 (Y278*)
Ref Sequence ENSEMBL: ENSMUSP00000121696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]
Predicted Effect probably null
Transcript: ENSMUST00000035342
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: Y278*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155907
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: Y278*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 critical splice donor site probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 splice site probably null
IGL03088:Adamts20 APN 15 94329914 critical splice donor site probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 intron probably benign
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
splotch2 UTSW 15 94335561 intron probably benign
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense probably damaging 1.00
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6419:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 intron probably null
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably null
R7186:Adamts20 UTSW 15 94322808 missense possibly damaging 0.76
R7263:Adamts20 UTSW 15 94322891 missense possibly damaging 0.52
R7441:Adamts20 UTSW 15 94353673 missense probably damaging 1.00
R7519:Adamts20 UTSW 15 94325988 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCTGTTCTTATAGAGGACACACTCAG -3'
(R):5'- AAAACTGCTTTGCCCTCTCAGAG -3'

Sequencing Primer
(F):5'- ACACTCAGTGCCCATGGAG -3'
(R):5'- TGCCCTCTCAGAGCTCCAG -3'
Posted On2018-10-18