Incidental Mutation 'R6864:Prkacb'
ID535793
Institutional Source Beutler Lab
Gene Symbol Prkacb
Ensembl Gene ENSMUSG00000005034
Gene Nameprotein kinase, cAMP dependent, catalytic, beta
SynonymscAMP-dependent protein kinase C beta, Pkacb
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146729574-146812990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146745378 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 204 (Y204C)
Ref Sequence ENSEMBL: ENSMUSP00000101744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005164] [ENSMUST00000102515] [ENSMUST00000106137] [ENSMUST00000106138] [ENSMUST00000197616] [ENSMUST00000199722]
Predicted Effect probably damaging
Transcript: ENSMUST00000005164
AA Change: Y263C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005164
Gene: ENSMUSG00000005034
AA Change: Y263C

DomainStartEndE-ValueType
S_TKc 91 345 1.07e-105 SMART
S_TK_X 346 398 2.47e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102515
AA Change: Y216C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099573
Gene: ENSMUSG00000005034
AA Change: Y216C

DomainStartEndE-ValueType
S_TKc 44 298 5.3e-108 SMART
S_TK_X 299 344 2.1e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106137
AA Change: Y203C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101743
Gene: ENSMUSG00000005034
AA Change: Y203C

DomainStartEndE-ValueType
S_TKc 31 285 1.07e-105 SMART
S_TK_X 286 338 2.47e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106138
AA Change: Y204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101744
Gene: ENSMUSG00000005034
AA Change: Y204C

DomainStartEndE-ValueType
S_TKc 32 286 1.07e-105 SMART
S_TK_X 287 339 2.47e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197616
SMART Domains Protein: ENSMUSP00000142490
Gene: ENSMUSG00000005034

DomainStartEndE-ValueType
Pfam:Pkinase 69 189 4.6e-27 PFAM
Pfam:Pkinase_Tyr 69 189 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199722
SMART Domains Protein: ENSMUSP00000143303
Gene: ENSMUSG00000005034

DomainStartEndE-ValueType
STYKc 1 106 1.5e-6 SMART
Meta Mutation Damage Score 0.8361 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes for a targeted null mutation eliminating the Cbeta1 subunit exhibit impaired hippocampal plasticity, including failure of low frequency stimulation to produce lasting depression and the elimination of mossy fiber long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Prkacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Prkacb APN 3 146748042 missense probably benign 0.01
IGL01330:Prkacb APN 3 146751511 missense probably damaging 1.00
IGL01419:Prkacb APN 3 146755693 start codon destroyed probably null 0.49
IGL02533:Prkacb APN 3 146732696 missense possibly damaging 0.64
foxhound UTSW 3 146745378 missense probably damaging 1.00
PIT4445001:Prkacb UTSW 3 146755691 missense probably benign 0.13
R0666:Prkacb UTSW 3 146751518 missense probably damaging 0.99
R2169:Prkacb UTSW 3 146746683 unclassified probably null
R4559:Prkacb UTSW 3 146745392 unclassified probably benign
R4613:Prkacb UTSW 3 146737998 missense probably damaging 1.00
R4931:Prkacb UTSW 3 146747977 missense possibly damaging 0.91
R6474:Prkacb UTSW 3 146755724 missense probably damaging 1.00
R6505:Prkacb UTSW 3 146732646 missense probably damaging 1.00
R6654:Prkacb UTSW 3 146750543 missense possibly damaging 0.77
R6940:Prkacb UTSW 3 146751499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATGGCTCGAATCTGCAGC -3'
(R):5'- GGACTCAGATTTAACAGTTCTTCCC -3'

Sequencing Primer
(F):5'- TGCAGCTTTAACTTCACGCAGAG -3'
(R):5'- TAACAGTTCTTCCCAATAACACATTC -3'
Posted On2018-10-18