Incidental Mutation 'R6864:Lcorl'
ID535798
Institutional Source Beutler Lab
Gene Symbol Lcorl
Ensembl Gene ENSMUSG00000015882
Gene Nameligand dependent nuclear receptor corepressor-like
SynonymsMlr1, A830039H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location45697181-45857615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45747204 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 177 (K177N)
Ref Sequence ENSEMBL: ENSMUSP00000042677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016026] [ENSMUST00000045586] [ENSMUST00000087164] [ENSMUST00000121573] [ENSMUST00000189859] [ENSMUST00000190036]
Predicted Effect probably benign
Transcript: ENSMUST00000016026
AA Change: K177N

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000016026
Gene: ENSMUSG00000015882
AA Change: K177N

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Pfam:HTH_psq 276 313 5.1e-9 PFAM
Pfam:HTH_psq 525 570 1.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045586
AA Change: K177N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882
AA Change: K177N

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087164
AA Change: K94N

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000084408
Gene: ENSMUSG00000015882
AA Change: K94N

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Pfam:HTH_psq 193 230 3.4e-7 PFAM
Pfam:HTH_psq 442 487 9.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121573
AA Change: K94N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112416
Gene: ENSMUSG00000015882
AA Change: K94N

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187615
Predicted Effect probably benign
Transcript: ENSMUST00000189859
SMART Domains Protein: ENSMUSP00000139996
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
Blast:ZnF_C2H2 16 38 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000190036
AA Change: K167N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that appears to function in spermatogenesis. Polymorphisms in this gene are associated with measures of skeletal frame size and adult height. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Lcorl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Lcorl APN 5 45747295 missense probably damaging 1.00
IGL01611:Lcorl APN 5 45747092 missense probably damaging 1.00
IGL03014:Lcorl UTSW 5 45774029 intron probably benign
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0499:Lcorl UTSW 5 45734369 missense probably benign 0.00
R1518:Lcorl UTSW 5 45734201 missense possibly damaging 0.94
R1817:Lcorl UTSW 5 45795346 missense probably damaging 1.00
R1977:Lcorl UTSW 5 45775420 missense probably null 0.16
R2171:Lcorl UTSW 5 45747151 missense probably damaging 0.99
R3737:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3738:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3739:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3825:Lcorl UTSW 5 45775387 splice site probably benign
R4035:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R4199:Lcorl UTSW 5 45733788 missense possibly damaging 0.83
R4583:Lcorl UTSW 5 45733589 nonsense probably null
R4647:Lcorl UTSW 5 45733589 nonsense probably null
R4803:Lcorl UTSW 5 45747281 unclassified probably null
R5524:Lcorl UTSW 5 45775522 critical splice acceptor site probably null
R5524:Lcorl UTSW 5 45775523 critical splice acceptor site probably null
R5526:Lcorl UTSW 5 45733727 missense probably benign
R5533:Lcorl UTSW 5 45733877 missense possibly damaging 0.47
R5772:Lcorl UTSW 5 45795367 splice site probably null
R5927:Lcorl UTSW 5 45725424 intron probably benign
R6175:Lcorl UTSW 5 45776490 missense probably damaging 1.00
R6734:Lcorl UTSW 5 45733497 missense probably damaging 0.98
R7078:Lcorl UTSW 5 45747224 missense probably damaging 1.00
R7396:Lcorl UTSW 5 45857459 synonymous probably null
R7624:Lcorl UTSW 5 45701965 missense probably benign
X0023:Lcorl UTSW 5 45734012 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAATGAGATTCTTACTGTGTACTCC -3'
(R):5'- ACCACTGTGAACTGCCACTAG -3'

Sequencing Primer
(F):5'- GGCATGCACTGTTTTCCCAGAG -3'
(R):5'- TGAACTGCCACTAGATTCTAATAATG -3'
Posted On2018-10-18