Incidental Mutation 'R6864:Tmem175'
ID535799
Institutional Source Beutler Lab
Gene Symbol Tmem175
Ensembl Gene ENSMUSG00000013495
Gene Nametransmembrane protein 175
Synonyms3010001K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108629770-108648782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108645979 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 325 (H325P)
Ref Sequence ENSEMBL: ENSMUSP00000112780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053913] [ENSMUST00000063272] [ENSMUST00000078323] [ENSMUST00000120327] [ENSMUST00000132179] [ENSMUST00000132708] [ENSMUST00000146207] [ENSMUST00000153238]
Predicted Effect probably benign
Transcript: ENSMUST00000053913
SMART Domains Protein: ENSMUSP00000057859
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
C1 114 162 1.73e-2 SMART
C1 178 228 1.58e-13 SMART
low complexity region 267 275 N/A INTRINSIC
RA 387 486 2.08e-20 SMART
DAGKc 580 707 4.79e-63 SMART
DAGKa 733 885 7e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063272
AA Change: H325P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068607
Gene: ENSMUSG00000013495
AA Change: H325P

DomainStartEndE-ValueType
Pfam:DUF1211 31 121 7.3e-28 PFAM
transmembrane domain 135 157 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
Pfam:DUF1211 256 353 4.4e-36 PFAM
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078323
AA Change: H325P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077437
Gene: ENSMUSG00000013495
AA Change: H325P

DomainStartEndE-ValueType
Pfam:DUF1211 31 121 7.3e-28 PFAM
transmembrane domain 135 157 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
Pfam:DUF1211 256 353 4.4e-36 PFAM
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120327
AA Change: H325P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112780
Gene: ENSMUSG00000013495
AA Change: H325P

DomainStartEndE-ValueType
Pfam:DUF1211 32 121 1.5e-22 PFAM
transmembrane domain 135 157 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
Pfam:DUF1211 257 353 9.5e-27 PFAM
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132179
SMART Domains Protein: ENSMUSP00000118466
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146207
SMART Domains Protein: ENSMUSP00000143596
Gene: ENSMUSG00000013495

DomainStartEndE-ValueType
Pfam:DUF1211 32 121 5.4e-23 PFAM
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 185 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153238
SMART Domains Protein: ENSMUSP00000118065
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Tmem175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Tmem175 APN 5 108645866 missense probably benign 0.00
IGL02034:Tmem175 APN 5 108642136 missense probably damaging 1.00
R0057:Tmem175 UTSW 5 108639562 missense probably damaging 1.00
R0057:Tmem175 UTSW 5 108639562 missense probably damaging 1.00
R2294:Tmem175 UTSW 5 108638659 splice site probably benign
R4576:Tmem175 UTSW 5 108644602 missense possibly damaging 0.83
R4707:Tmem175 UTSW 5 108642150 missense probably damaging 0.99
R5063:Tmem175 UTSW 5 108646432 missense probably damaging 0.99
R6248:Tmem175 UTSW 5 108645955 missense probably damaging 0.99
R6950:Tmem175 UTSW 5 108643082 missense probably benign 0.02
R7562:Tmem175 UTSW 5 108641849 missense probably damaging 0.99
R7648:Tmem175 UTSW 5 108644566 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGGGAGGTTGTTACAAATGCC -3'
(R):5'- GTTTCTGTCTGATGCAGCAG -3'

Sequencing Primer
(F):5'- GAGGTTGTTACAAATGCCATCTG -3'
(R):5'- CTGTAGTCCAGATGGCAAACTG -3'
Posted On2018-10-18