Mutagenetix > Incidental Mutations

Incidental Mutation 'R6864:Kel'

535803

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

MMRRC Submission

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R6864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 41703760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899]

AlphaFold

Q9EQF2

Predicted Effect

probably null
Transcript: ENSMUST00000031899

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000192118

Meta Mutation Damage Score

0.9373

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	C	T	17: 57,478,879	T875I	probably damaging	Het
Anln	A	T	9: 22,382,249	S33T	probably benign	Het
Anxa6	T	C	11: 54,986,185	T541A	probably benign	Het
Atxn2	C	T	5: 121,779,494	R334W	probably damaging	Het
AU040320	T	A	4: 126,847,819	V940D	probably damaging	Het
Bcl2	A	T	1: 106,543,281	Y232N	probably damaging	Het
Bmp7	A	G	2: 172,940,062	V3A	probably benign	Het
Calr	A	T	8: 84,844,928	H145Q	probably damaging	Het
Camta2	T	A	11: 70,671,966	T976S	probably benign	Het
Ccnk	G	A	12: 108,202,214		probably benign	Het
Cntln	T	C	4: 85,096,792	S1107P	probably damaging	Het
Cradd	T	C	10: 95,175,927	D117G	probably damaging	Het
Dcaf7	C	T	11: 106,046,821	T90I	probably damaging	Het
Defb30	T	A	14: 63,036,103		probably null	Het
Dock4	T	A	12: 40,745,746	I854N	probably damaging	Het
Dym	T	A	18: 75,056,738	Y132*	probably null	Het
Eef1a2	T	C	2: 181,149,684	T341A	probably benign	Het
Eml2	T	C	7: 19,196,281	V309A	probably damaging	Het
Fam208a	T	A	14: 27,461,158	F525I	probably damaging	Het
Flnb	C	T	14: 7,905,640	P1130L	possibly damaging	Het
Hivep3	C	A	4: 120,094,888	Q134K	possibly damaging	Het
Kbtbd2	T	A	6: 56,780,026	K242*	probably null	Het
Lcorl	T	A	5: 45,747,204	K177N	probably damaging	Het
Mbd3l2	A	G	9: 18,443,499		probably benign	Het
Mcm3ap	A	G	10: 76,507,479	D1735G	probably damaging	Het
Ms4a1	C	A	19: 11,253,178		probably null	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Mylk	C	A	16: 34,874,150	P193Q	probably benign	Het
Olfr1275	C	T	2: 111,231,197	V199I	probably benign	Het
Olfr1388	G	T	11: 49,443,940	A30S	probably benign	Het
Olfr1390	A	T	11: 49,340,753	T74S	probably damaging	Het
Olfr1424	A	T	19: 12,059,413	F113Y	probably damaging	Het
Olfr339	T	A	2: 36,421,820	C141S	probably damaging	Het
Otogl	C	T	10: 107,827,806	S968N	probably damaging	Het
Oxr1	T	G	15: 41,823,387	V555G	probably damaging	Het
Parp12	T	C	6: 39,111,736	I189V	probably benign	Het
Peg3	T	C	7: 6,712,762	Y103C	probably damaging	Het
Plekhh2	T	C	17: 84,617,999	V1408A	probably benign	Het
Prkacb	T	C	3: 146,745,378	Y204C	probably damaging	Het
Prkch	A	G	12: 73,759,617	E546G	probably damaging	Het
Prss12	C	A	3: 123,447,384	H76N	probably benign	Het
Rai14	G	T	15: 10,633,168	S45R	possibly damaging	Het
Samd9l	T	A	6: 3,374,750	D837V	probably benign	Het
Slc22a6	G	T	19: 8,618,441	C49F	probably damaging	Het
Slc2a2	T	A	3: 28,721,725	I328N	probably damaging	Het
Slc35f4	T	C	14: 49,318,853	I148V	possibly damaging	Het
Stk32b	A	T	5: 37,448,805		probably null	Het
Tktl2	T	C	8: 66,512,339	I183T	probably damaging	Het
Tmem175	A	C	5: 108,645,979	H325P	probably damaging	Het
Tns3	A	G	11: 8,493,196	V389A	probably damaging	Het
Trappc9	A	T	15: 72,937,162		probably null	Het
Trim28	T	A	7: 13,029,458	F509I	possibly damaging	Het
Vmn1r210	T	A	13: 22,827,543	Q191L	probably benign	Het
Vmn2r24	A	T	6: 123,779,158	D63V	possibly damaging	Het
Zfp536	A	G	7: 37,568,515	L492P	probably damaging	Het
Zfp831	C	A	2: 174,646,740	N1069K	possibly damaging	Het
Zfp943	T	A	17: 21,992,612	H226Q	probably damaging	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R0658:Kel	UTSW	6	41703031	missense	probably damaging	1.00
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1531:Kel	UTSW	6	41688626	missense	probably damaging	0.99
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2118:Kel	UTSW	6	41689300	missense	probably benign
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5745:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5978:Kel	UTSW	6	41688045	missense	probably benign	0.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6368:Kel	UTSW	6	41688851	nonsense	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R7938:Kel	UTSW	6	41698376	missense	probably benign	0.06
R8028:Kel	UTSW	6	41699024	missense	probably benign	0.21
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
R8465:Kel	UTSW	6	41689538	critical splice donor site	probably null
R9158:Kel	UTSW	6	41687971	missense	probably benign	0.10
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGAGAACTCTAGTCAGGGAAC -3'
(R):5'- GCTTCATTCGGGAAATGGCC -3'

Sequencing Primer
(F):5'- AAAAACATCACAAAGAAGTTTGGG -3'
(R):5'- CTTCATTCGGGAAATGGCCTTAAG -3'

Posted On

2018-10-18