Incidental Mutation 'R6864:Zfp536'
ID535809
Institutional Source Beutler Lab
Gene Symbol Zfp536
Ensembl Gene ENSMUSG00000043456
Gene Namezinc finger protein 536
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location37472135-37773641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37568515 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 492 (L492P)
Ref Sequence ENSEMBL: ENSMUSP00000135068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056338] [ENSMUST00000175941] [ENSMUST00000176114] [ENSMUST00000176205] [ENSMUST00000176534] [ENSMUST00000176680]
Predicted Effect probably damaging
Transcript: ENSMUST00000056338
AA Change: L492P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058468
Gene: ENSMUSG00000043456
AA Change: L492P

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
Pfam:zf-C2H2_assoc 657 739 6.6e-43 PFAM
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175941
AA Change: L492P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134778
Gene: ENSMUSG00000043456
AA Change: L492P

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176114
AA Change: L492P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135681
Gene: ENSMUSG00000043456
AA Change: L492P

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176205
AA Change: L492P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135068
Gene: ENSMUSG00000043456
AA Change: L492P

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176534
Predicted Effect probably benign
Transcript: ENSMUST00000176680
SMART Domains Protein: ENSMUSP00000135218
Gene: ENSMUSG00000043456

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
Meta Mutation Damage Score 0.6238 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a highly conserved zinc finger protein. The encoded protein is most abundant in brain, where it negatively regulates neuronal differentiation. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Zfp536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Zfp536 APN 7 37567890 missense probably damaging 0.99
IGL02729:Zfp536 APN 7 37493718 missense probably damaging 1.00
PIT4453001:Zfp536 UTSW 7 37479757 missense probably benign 0.08
R0211:Zfp536 UTSW 7 37568449 missense probably damaging 1.00
R0369:Zfp536 UTSW 7 37567948 missense probably damaging 1.00
R0504:Zfp536 UTSW 7 37568818 missense probably damaging 1.00
R0554:Zfp536 UTSW 7 37480819 missense probably damaging 1.00
R1171:Zfp536 UTSW 7 37569634 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1699:Zfp536 UTSW 7 37569454 missense probably damaging 1.00
R1817:Zfp536 UTSW 7 37568617 missense probably damaging 1.00
R1918:Zfp536 UTSW 7 37480199 missense probably damaging 1.00
R2252:Zfp536 UTSW 7 37479389 missense probably benign 0.30
R2288:Zfp536 UTSW 7 37480348 missense probably damaging 0.98
R2509:Zfp536 UTSW 7 37567978 missense possibly damaging 0.87
R3967:Zfp536 UTSW 7 37473830 makesense probably null
R4039:Zfp536 UTSW 7 37569550 missense probably damaging 1.00
R4600:Zfp536 UTSW 7 37568493 missense probably damaging 1.00
R4706:Zfp536 UTSW 7 37569466 missense probably damaging 1.00
R4771:Zfp536 UTSW 7 37568884 missense probably damaging 1.00
R4808:Zfp536 UTSW 7 37479305 missense probably damaging 1.00
R4945:Zfp536 UTSW 7 37569736 missense probably damaging 1.00
R5196:Zfp536 UTSW 7 37480760 missense probably damaging 1.00
R5506:Zfp536 UTSW 7 37568792 missense probably damaging 1.00
R5816:Zfp536 UTSW 7 37480628 missense probably damaging 1.00
R6114:Zfp536 UTSW 7 37479736 missense probably damaging 0.99
R6131:Zfp536 UTSW 7 37569712 missense probably damaging 1.00
R6156:Zfp536 UTSW 7 37473856 missense unknown
R6257:Zfp536 UTSW 7 37480405 missense probably damaging 1.00
R6975:Zfp536 UTSW 7 37568527 missense probably damaging 1.00
R6976:Zfp536 UTSW 7 37480403 missense probably damaging 1.00
R7176:Zfp536 UTSW 7 37480851 critical splice acceptor site probably null
R7247:Zfp536 UTSW 7 37569206 missense probably benign 0.04
R7325:Zfp536 UTSW 7 37479860 missense probably benign
R7650:Zfp536 UTSW 7 37569692 missense probably damaging 1.00
R7782:Zfp536 UTSW 7 37568701 missense probably damaging 1.00
R7827:Zfp536 UTSW 7 37569688 missense probably damaging 1.00
R8013:Zfp536 UTSW 7 37569610 missense probably damaging 1.00
X0066:Zfp536 UTSW 7 37569781 missense possibly damaging 0.93
Z1176:Zfp536 UTSW 7 37493812 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTTCTGCTTGGAGCCATCTG -3'
(R):5'- CCTGCAGAGTGGCTTTATGG -3'

Sequencing Primer
(F):5'- AACTCCGGTGTTTGCCAAAG -3'
(R):5'- GGCTTTATGGCCCCAGACAAAG -3'
Posted On2018-10-18