Incidental Mutation 'R6864:Calr'
ID535812
Institutional Source Beutler Lab
Gene Symbol Calr
Ensembl Gene ENSMUSG00000003814
Gene Namecalreticulin
SynonymsCalregulin, CRT
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84841850-84846934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84844928 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 145 (H145Q)
Ref Sequence ENSEMBL: ENSMUSP00000003912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003911] [ENSMUST00000003912] [ENSMUST00000109761] [ENSMUST00000128035]
PDB Structure
Crystal structure of the calreticulin lectin domain [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural and functional relationships between the lectin and arm domains of calreticulin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000003911
SMART Domains Protein: ENSMUSP00000003911
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 229 272 5.7e-8 SMART
low complexity region 296 307 N/A INTRINSIC
UBA 319 356 9.11e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000003912
AA Change: H145Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003912
Gene: ENSMUSG00000003814
AA Change: H145Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Calreticulin 23 258 2.7e-64 PFAM
Pfam:Calreticulin 257 332 3.3e-24 PFAM
low complexity region 358 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109761
SMART Domains Protein: ENSMUSP00000105383
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 230 273 5.7e-8 SMART
low complexity region 297 308 N/A INTRINSIC
UBA 320 357 9.11e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128035
SMART Domains Protein: ENSMUSP00000115664
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 230 273 5.7e-8 SMART
Meta Mutation Damage Score 0.8861 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calreticulin is a multifunctional protein that acts as a major Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. It is also found in the nucleus, suggesting that it may have a role in transcription regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is almost identical to an amino acid sequence in the DNA-binding domain of the superfamily of nuclear receptors. Calreticulin binds to antibodies in certain sera of systemic lupus and Sjogren patients which contain anti-Ro/SSA antibodies, it is highly conserved among species, and it is located in the endoplasmic and sarcoplasmic reticulum where it may bind calcium. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin can inhibit the binding of androgen receptor to its hormone-responsive DNA element and can inhibit androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Thus, calreticulin can act as an important modulator of the regulation of gene transcription by nuclear hormone receptors. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin but calreticulin is not a Ro/SS-A antigen. Earlier papers referred to calreticulin as an Ro/SS-A antigen but this was later disproven. Increased autoantibody titer against human calreticulin is found in infants with complete congenital heart block of both the IgG and IgM classes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit decreased cardiac cell mass, increased apoptosis of cardiac myocytes, neural tube defects (sometimes associated with exencephaly), omphalocele, and mid- to late-gestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Calr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Calr APN 8 84844744 missense possibly damaging 0.89
IGL00648:Calr APN 8 84842702 unclassified probably benign
IGL01309:Calr APN 8 84846706 critical splice donor site probably null
IGL01910:Calr APN 8 84844969 unclassified probably benign
IGL01918:Calr APN 8 84842850 unclassified probably benign
IGL02399:Calr APN 8 84842786 unclassified probably benign
IGL02749:Calr APN 8 84844488 missense probably damaging 1.00
IGL02858:Calr APN 8 84844899 missense probably benign 0.07
IGL03090:Calr APN 8 84846744 missense possibly damaging 0.82
K3955:Calr UTSW 8 84846273 missense probably damaging 1.00
R0309:Calr UTSW 8 84843031 missense probably benign 0.43
R1670:Calr UTSW 8 84844119 missense probably benign 0.24
R1974:Calr UTSW 8 84844157 missense probably benign
R7120:Calr UTSW 8 84842828 missense probably damaging 0.98
Z1176:Calr UTSW 8 84844064 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTCTGGCCGCACAATCAG -3'
(R):5'- TTTCAGAGAACACAAGCTCAGTTC -3'

Sequencing Primer
(F):5'- ACAATCAGTGTGTATAGGTGTGTG -3'
(R):5'- AGCTCAGTTCCCAGCACTC -3'
Posted On2018-10-18