Mutagenetix > Incidental Mutation

Incidental Mutation 'R6864:Calr'

535812

Institutional Source

Beutler Lab

Gene Symbol

Calr

Ensembl Gene

ENSMUSG00000003814

Gene Name

calreticulin

Synonyms

Calregulin, CRT

MMRRC Submission

044964-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85568717-85573560 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85571557 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 145 (H145Q)

Ref Sequence

ENSEMBL: ENSMUSP00000003912 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003911] [ENSMUST00000003912] [ENSMUST00000109761] [ENSMUST00000128035]

AlphaFold

P14211

PDB Structure

Crystal structure of the calreticulin lectin domain [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural and functional relationships between the lectin and arm domains of calreticulin [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000003911

SMART Domains

Protein: ENSMUSP00000003911
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
UBQ	3	77	3.28e-23	SMART
low complexity region	123	151	N/A	INTRINSIC
UBA	163	200	8.76e-11	SMART
STI1	229	272	5.7e-8	SMART
low complexity region	296	307	N/A	INTRINSIC
UBA	319	356	9.11e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000003912
AA Change: H145Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000003912
Gene: ENSMUSG00000003814
AA Change: H145Q

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Calreticulin	23	258	2.7e-64	PFAM
Pfam:Calreticulin	257	332	3.3e-24	PFAM
low complexity region	358	407	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109761

SMART Domains

Protein: ENSMUSP00000105383
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
UBQ	3	77	3.28e-23	SMART
low complexity region	123	151	N/A	INTRINSIC
UBA	163	200	8.76e-11	SMART
STI1	230	273	5.7e-8	SMART
low complexity region	297	308	N/A	INTRINSIC
UBA	320	357	9.11e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128035

SMART Domains

Protein: ENSMUSP00000115664
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
UBQ	3	77	3.28e-23	SMART
low complexity region	123	151	N/A	INTRINSIC
UBA	163	200	8.76e-11	SMART
STI1	230	273	5.7e-8	SMART

Meta Mutation Damage Score

0.8861

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calreticulin is a multifunctional protein that acts as a major Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. It is also found in the nucleus, suggesting that it may have a role in transcription regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is almost identical to an amino acid sequence in the DNA-binding domain of the superfamily of nuclear receptors. Calreticulin binds to antibodies in certain sera of systemic lupus and Sjogren patients which contain anti-Ro/SSA antibodies, it is highly conserved among species, and it is located in the endoplasmic and sarcoplasmic reticulum where it may bind calcium. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin can inhibit the binding of androgen receptor to its hormone-responsive DNA element and can inhibit androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Thus, calreticulin can act as an important modulator of the regulation of gene transcription by nuclear hormone receptors. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin but calreticulin is not a Ro/SS-A antigen. Earlier papers referred to calreticulin as an Ro/SS-A antigen but this was later disproven. Increased autoantibody titer against human calreticulin is found in infants with complete congenital heart block of both the IgG and IgM classes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit decreased cardiac cell mass, increased apoptosis of cardiac myocytes, neural tube defects (sometimes associated with exencephaly), omphalocele, and mid- to late-gestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	C	T	17: 57,785,879 (GRCm39)	T875I	probably damaging	Het
Anln	A	T	9: 22,293,545 (GRCm39)	S33T	probably benign	Het
Anxa6	T	C	11: 54,877,011 (GRCm39)	T541A	probably benign	Het
Atxn2	C	T	5: 121,917,557 (GRCm39)	R334W	probably damaging	Het
AU040320	T	A	4: 126,741,612 (GRCm39)	V940D	probably damaging	Het
Bcl2	A	T	1: 106,471,011 (GRCm39)	Y232N	probably damaging	Het
Bmp7	A	G	2: 172,781,855 (GRCm39)	V3A	probably benign	Het
Camta2	T	A	11: 70,562,792 (GRCm39)	T976S	probably benign	Het
Ccnk	G	A	12: 108,168,473 (GRCm39)		probably benign	Het
Cntln	T	C	4: 85,015,029 (GRCm39)	S1107P	probably damaging	Het
Cradd	T	C	10: 95,011,789 (GRCm39)	D117G	probably damaging	Het
Dcaf7	C	T	11: 105,937,647 (GRCm39)	T90I	probably damaging	Het
Defb30	T	A	14: 63,273,552 (GRCm39)		probably null	Het
Dock4	T	A	12: 40,795,745 (GRCm39)	I854N	probably damaging	Het
Dym	T	A	18: 75,189,809 (GRCm39)	Y132*	probably null	Het
Eef1a2	T	C	2: 180,791,477 (GRCm39)	T341A	probably benign	Het
Eml2	T	C	7: 18,930,206 (GRCm39)	V309A	probably damaging	Het
Flnb	C	T	14: 7,905,640 (GRCm38)	P1130L	possibly damaging	Het
Hivep3	C	A	4: 119,952,085 (GRCm39)	Q134K	possibly damaging	Het
Kbtbd2	T	A	6: 56,757,011 (GRCm39)	K242*	probably null	Het
Kel	A	G	6: 41,680,694 (GRCm39)		probably null	Het
Lcorl	T	A	5: 45,904,546 (GRCm39)	K177N	probably damaging	Het
Mbd3l2	A	G	9: 18,354,795 (GRCm39)		probably benign	Het
Mcm3ap	A	G	10: 76,343,313 (GRCm39)	D1735G	probably damaging	Het
Ms4a1	C	A	19: 11,230,542 (GRCm39)		probably null	Het
Muc5ac	C	T	7: 141,363,481 (GRCm39)		probably benign	Het
Mylk	C	A	16: 34,694,520 (GRCm39)	P193Q	probably benign	Het
Or1j11	T	A	2: 36,311,832 (GRCm39)	C141S	probably damaging	Het
Or2y16	G	T	11: 49,334,767 (GRCm39)	A30S	probably benign	Het
Or2y17	A	T	11: 49,231,580 (GRCm39)	T74S	probably damaging	Het
Or4d10b	A	T	19: 12,036,777 (GRCm39)	F113Y	probably damaging	Het
Or4f52	C	T	2: 111,061,542 (GRCm39)	V199I	probably benign	Het
Otogl	C	T	10: 107,663,667 (GRCm39)	S968N	probably damaging	Het
Oxr1	T	G	15: 41,686,783 (GRCm39)	V555G	probably damaging	Het
Parp12	T	C	6: 39,088,670 (GRCm39)	I189V	probably benign	Het
Peg3	T	C	7: 6,715,761 (GRCm39)	Y103C	probably damaging	Het
Plekhh2	T	C	17: 84,925,427 (GRCm39)	V1408A	probably benign	Het
Prkacb	T	C	3: 146,451,133 (GRCm39)	Y204C	probably damaging	Het
Prkch	A	G	12: 73,806,391 (GRCm39)	E546G	probably damaging	Het
Prss12	C	A	3: 123,241,033 (GRCm39)	H76N	probably benign	Het
Rai14	G	T	15: 10,633,254 (GRCm39)	S45R	possibly damaging	Het
Samd9l	T	A	6: 3,374,750 (GRCm39)	D837V	probably benign	Het
Slc22a6	G	T	19: 8,595,805 (GRCm39)	C49F	probably damaging	Het
Slc2a2	T	A	3: 28,775,874 (GRCm39)	I328N	probably damaging	Het
Slc35f4	T	C	14: 49,556,310 (GRCm39)	I148V	possibly damaging	Het
Stk32b	A	T	5: 37,606,149 (GRCm39)		probably null	Het
Tasor	T	A	14: 27,183,115 (GRCm39)	F525I	probably damaging	Het
Tktl2	T	C	8: 66,964,991 (GRCm39)	I183T	probably damaging	Het
Tmem175	A	C	5: 108,793,845 (GRCm39)	H325P	probably damaging	Het
Tns3	A	G	11: 8,443,196 (GRCm39)	V389A	probably damaging	Het
Trappc9	A	T	15: 72,809,011 (GRCm39)		probably null	Het
Trim28	T	A	7: 12,763,385 (GRCm39)	F509I	possibly damaging	Het
Vmn1r210	T	A	13: 23,011,713 (GRCm39)	Q191L	probably benign	Het
Vmn2r24	A	T	6: 123,756,117 (GRCm39)	D63V	possibly damaging	Het
Zfp536	A	G	7: 37,267,940 (GRCm39)	L492P	probably damaging	Het
Zfp831	C	A	2: 174,488,533 (GRCm39)	N1069K	possibly damaging	Het
Zfp943	T	A	17: 22,211,593 (GRCm39)	H226Q	probably damaging	Het

Other mutations in Calr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Calr	APN	8	85,571,373 (GRCm39)	missense	possibly damaging	0.89
IGL00648:Calr	APN	8	85,569,331 (GRCm39)	unclassified	probably benign
IGL01309:Calr	APN	8	85,573,335 (GRCm39)	critical splice donor site	probably null
IGL01910:Calr	APN	8	85,571,598 (GRCm39)	unclassified	probably benign
IGL01918:Calr	APN	8	85,569,479 (GRCm39)	unclassified	probably benign
IGL02399:Calr	APN	8	85,569,415 (GRCm39)	unclassified	probably benign
IGL02749:Calr	APN	8	85,571,117 (GRCm39)	missense	probably damaging	1.00
IGL02858:Calr	APN	8	85,571,528 (GRCm39)	missense	probably benign	0.07
IGL03090:Calr	APN	8	85,573,373 (GRCm39)	missense	possibly damaging	0.82
K3955:Calr	UTSW	8	85,572,902 (GRCm39)	missense	probably damaging	1.00
R0309:Calr	UTSW	8	85,569,660 (GRCm39)	missense	probably benign	0.43
R1670:Calr	UTSW	8	85,570,748 (GRCm39)	missense	probably benign	0.24
R1974:Calr	UTSW	8	85,570,786 (GRCm39)	missense	probably benign
R7120:Calr	UTSW	8	85,569,457 (GRCm39)	missense	probably damaging	0.98
R9320:Calr	UTSW	8	85,572,629 (GRCm39)	nonsense	probably null
Z1176:Calr	UTSW	8	85,570,693 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTGTCTGGCCGCACAATCAG -3'
(R):5'- TTTCAGAGAACACAAGCTCAGTTC -3'

Sequencing Primer
(F):5'- ACAATCAGTGTGTATAGGTGTGTG -3'
(R):5'- AGCTCAGTTCCCAGCACTC -3'

Posted On

2018-10-18