Incidental Mutation 'R6864:Anxa6'
ID535821
Institutional Source Beutler Lab
Gene Symbol Anxa6
Ensembl Gene ENSMUSG00000018340
Gene Nameannexin A6
SynonymsAnxVI, Anx6, Cabm, Camb, Annexin VI
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location54979108-55033445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54986185 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 541 (T541A)
Ref Sequence ENSEMBL: ENSMUSP00000104511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102727] [ENSMUST00000108883]
Predicted Effect probably benign
Transcript: ENSMUST00000102727
AA Change: T535A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099788
Gene: ENSMUSG00000018340
AA Change: T535A

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
ANX 535 587 7.77e-12 SMART
ANX 610 662 4.73e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108883
AA Change: T541A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104511
Gene: ENSMUSG00000018340
AA Change: T541A

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
low complexity region 517 528 N/A INTRINSIC
ANX 541 593 7.77e-12 SMART
ANX 616 668 4.73e-25 SMART
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele have normal immunological development but exhibit altered cardiomyocyte mechanics and intracellular calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Anxa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Anxa6 APN 11 54992363 missense probably damaging 1.00
IGL02450:Anxa6 APN 11 54994941 missense probably damaging 1.00
R0220:Anxa6 UTSW 11 54981762 intron probably null
R0374:Anxa6 UTSW 11 55005828 missense probably benign 0.02
R0599:Anxa6 UTSW 11 54979466 missense possibly damaging 0.92
R0659:Anxa6 UTSW 11 54983347 missense probably damaging 0.99
R0924:Anxa6 UTSW 11 54994388 splice site probably null
R0930:Anxa6 UTSW 11 54994388 splice site probably null
R1005:Anxa6 UTSW 11 55001218 missense possibly damaging 0.89
R1435:Anxa6 UTSW 11 54991410 missense probably benign
R2314:Anxa6 UTSW 11 55011735 missense probably damaging 1.00
R2850:Anxa6 UTSW 11 55011026 missense possibly damaging 0.94
R4596:Anxa6 UTSW 11 54994583 splice site probably null
R5057:Anxa6 UTSW 11 55001236 missense possibly damaging 0.82
R5685:Anxa6 UTSW 11 54996370 missense probably benign
R5968:Anxa6 UTSW 11 54994341 missense probably damaging 1.00
R6145:Anxa6 UTSW 11 54994904 missense probably damaging 0.98
R6268:Anxa6 UTSW 11 54987077 splice site probably null
R6818:Anxa6 UTSW 11 54979500 missense probably benign
R7224:Anxa6 UTSW 11 54986167 missense probably damaging 1.00
R7595:Anxa6 UTSW 11 54985085 missense probably benign 0.00
R7740:Anxa6 UTSW 11 55007899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCATCTGCCTTGCTAAG -3'
(R):5'- TGGGATGACCACTGTACTCAG -3'

Sequencing Primer
(F):5'- AGCTCTGGAGTCCCCCAAC -3'
(R):5'- ACTGTACTCAGGCCGAGG -3'
Posted On2018-10-18