Incidental Mutation 'R6864:Camta2'
ID535822
Institutional Source Beutler Lab
Gene Symbol Camta2
Ensembl Gene ENSMUSG00000040712
Gene Namecalmodulin binding transcription activator 2
SynonymsKiaa0909-hp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.570) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70669463-70688105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70671966 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 976 (T976S)
Ref Sequence ENSEMBL: ENSMUSP00000104184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000036299] [ENSMUST00000100933] [ENSMUST00000108544] [ENSMUST00000108545] [ENSMUST00000119120] [ENSMUST00000120261] [ENSMUST00000129434] [ENSMUST00000145823]
Predicted Effect probably benign
Transcript: ENSMUST00000018431
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036299
AA Change: T981S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000043792
Gene: ENSMUSG00000040712
AA Change: T981S

DomainStartEndE-ValueType
CG-1 34 155 1.07e-83 SMART
low complexity region 232 243 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 417 435 N/A INTRINSIC
low complexity region 461 485 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Pfam:TIG 541 621 6.2e-13 PFAM
low complexity region 660 679 N/A INTRINSIC
Blast:ANK 717 750 7e-12 BLAST
SCOP:d1myo__ 718 816 2e-15 SMART
Blast:ANK 762 792 4e-11 BLAST
low complexity region 829 839 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
IQ 1053 1075 2.59e2 SMART
IQ 1076 1092 2.38e2 SMART
IQ 1106 1128 5.42e0 SMART
low complexity region 1140 1157 N/A INTRINSIC
low complexity region 1180 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100933
AA Change: T978S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000098493
Gene: ENSMUSG00000040712
AA Change: T978S

DomainStartEndE-ValueType
CG-1 36 152 8.08e-88 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
low complexity region 458 482 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:TIG 538 618 1.2e-8 PFAM
low complexity region 657 676 N/A INTRINSIC
Blast:ANK 714 747 8e-12 BLAST
SCOP:d1myo__ 715 813 2e-15 SMART
Blast:ANK 759 789 4e-11 BLAST
low complexity region 826 836 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 858 879 N/A INTRINSIC
IQ 1050 1072 2.59e2 SMART
IQ 1073 1095 1.18e1 SMART
IQ 1096 1118 5.42e0 SMART
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1170 1180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108544
AA Change: T976S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104184
Gene: ENSMUSG00000040712
AA Change: T976S

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.2e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 4e-11 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1087 2.38e2 SMART
IQ 1101 1123 5.42e0 SMART
low complexity region 1135 1152 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108545
AA Change: T952S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104185
Gene: ENSMUSG00000040712
AA Change: T952S

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1.1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 5e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1069 1.18e1 SMART
IQ 1070 1092 5.42e0 SMART
low complexity region 1104 1121 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119120
AA Change: T976S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113847
Gene: ENSMUSG00000040712
AA Change: T976S

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.1e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 8e-13 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1093 1.18e1 SMART
IQ 1094 1116 5.42e0 SMART
low complexity region 1128 1145 N/A INTRINSIC
low complexity region 1168 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120261
AA Change: T952S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113667
Gene: ENSMUSG00000040712
AA Change: T952S

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 7e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1063 2.38e2 SMART
IQ 1077 1099 5.42e0 SMART
low complexity region 1111 1128 N/A INTRINSIC
low complexity region 1151 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129434
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145823
SMART Domains Protein: ENSMUSP00000123602
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 137 2.55e-44 SMART
low complexity region 146 165 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the calmodulin-binding transcription activator protein family. Members of this family share a common domain structure that consists of a transcription activation domain, a DNA-binding domain, and a calmodulin-binding domain. The encoded protein may be a transcriptional coactivator of genes involved in cardiac growth. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious cardiac defects, but show reduced pathophysiologic cardiac hypertrophy in response to diverse stress stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Camta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Camta2 APN 11 70671482 nonsense probably null
IGL01472:Camta2 APN 11 70684124 missense probably damaging 1.00
IGL02548:Camta2 APN 11 70670685 missense probably damaging 1.00
IGL02794:Camta2 APN 11 70675658 missense possibly damaging 0.94
IGL02983:Camta2 APN 11 70672022 missense probably damaging 0.99
IGL03035:Camta2 APN 11 70671509 nonsense probably null
weeping UTSW 11 70683308 missense probably damaging 1.00
Willow UTSW 11 70678325 missense probably damaging 1.00
P0027:Camta2 UTSW 11 70684005 missense probably damaging 1.00
R0360:Camta2 UTSW 11 70683310 missense probably damaging 1.00
R0364:Camta2 UTSW 11 70683310 missense probably damaging 1.00
R0541:Camta2 UTSW 11 70681621 missense probably benign 0.01
R0600:Camta2 UTSW 11 70673959 missense possibly damaging 0.94
R0630:Camta2 UTSW 11 70678305 missense probably damaging 1.00
R1301:Camta2 UTSW 11 70676404 missense probably benign 0.18
R1346:Camta2 UTSW 11 70676467 missense possibly damaging 0.89
R1826:Camta2 UTSW 11 70683308 missense probably damaging 1.00
R1881:Camta2 UTSW 11 70672016 missense probably benign 0.00
R1980:Camta2 UTSW 11 70682482 missense probably benign 0.43
R2144:Camta2 UTSW 11 70671575 missense probably benign 0.31
R2145:Camta2 UTSW 11 70671575 missense probably benign 0.31
R2763:Camta2 UTSW 11 70682530 nonsense probably null
R2881:Camta2 UTSW 11 70679664 splice site probably null
R2917:Camta2 UTSW 11 70680961 missense probably damaging 1.00
R4115:Camta2 UTSW 11 70676474 missense possibly damaging 0.93
R4321:Camta2 UTSW 11 70678325 missense probably damaging 1.00
R4470:Camta2 UTSW 11 70680940 missense probably damaging 1.00
R4499:Camta2 UTSW 11 70674686 missense probably damaging 1.00
R4509:Camta2 UTSW 11 70681018 missense probably benign 0.28
R6154:Camta2 UTSW 11 70678385 missense probably damaging 1.00
R6166:Camta2 UTSW 11 70674261 splice site probably null
R6287:Camta2 UTSW 11 70681469 missense probably damaging 0.98
R6382:Camta2 UTSW 11 70672041 missense probably damaging 0.99
R6922:Camta2 UTSW 11 70674138 missense probably benign 0.04
R7438:Camta2 UTSW 11 70683888 critical splice donor site probably null
R7611:Camta2 UTSW 11 70681546 missense possibly damaging 0.85
R7883:Camta2 UTSW 11 70675211 missense probably damaging 1.00
R7955:Camta2 UTSW 11 70675745 splice site probably null
R7966:Camta2 UTSW 11 70675211 missense probably damaging 1.00
T0722:Camta2 UTSW 11 70684005 missense probably damaging 1.00
X0066:Camta2 UTSW 11 70681678 missense probably benign 0.08
Z1177:Camta2 UTSW 11 70675221 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAGAGTTCACCAGCCTGC -3'
(R):5'- AGCTGTGCTGGAACATTGATAGTG -3'

Sequencing Primer
(F):5'- TCTCACCACTCCAGGGC -3'
(R):5'- CATTGATAGTGAGGGCTCCAC -3'
Posted On2018-10-18