Mutagenetix > Incidental Mutation

Incidental Mutation 'R6864:Rai14'

535832

Institutional Source

Beutler Lab

Gene Symbol

Rai14

Ensembl Gene

ENSMUSG00000022246

Gene Name

retinoic acid induced 14

Synonyms

1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.396) question?

Stock #

R6864 (G1)

Quality Score

178.009

Status

Validated

Chromosome

Chromosomal Location

10568969-10714624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 10633168 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 45 (S45R)

Ref Sequence

ENSEMBL: ENSMUSP00000126325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]

AlphaFold

Q9EP71

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090339
AA Change: S45R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: S45R

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169385
AA Change: S45R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: S45R

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227506
AA Change: S45R

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	C	T	17: 57,478,879	T875I	probably damaging	Het
Anln	A	T	9: 22,382,249	S33T	probably benign	Het
Anxa6	T	C	11: 54,986,185	T541A	probably benign	Het
Atxn2	C	T	5: 121,779,494	R334W	probably damaging	Het
AU040320	T	A	4: 126,847,819	V940D	probably damaging	Het
Bcl2	A	T	1: 106,543,281	Y232N	probably damaging	Het
Bmp7	A	G	2: 172,940,062	V3A	probably benign	Het
Calr	A	T	8: 84,844,928	H145Q	probably damaging	Het
Camta2	T	A	11: 70,671,966	T976S	probably benign	Het
Ccnk	G	A	12: 108,202,214		probably benign	Het
Cntln	T	C	4: 85,096,792	S1107P	probably damaging	Het
Cradd	T	C	10: 95,175,927	D117G	probably damaging	Het
Dcaf7	C	T	11: 106,046,821	T90I	probably damaging	Het
Defb30	T	A	14: 63,036,103		probably null	Het
Dock4	T	A	12: 40,745,746	I854N	probably damaging	Het
Dym	T	A	18: 75,056,738	Y132*	probably null	Het
Eef1a2	T	C	2: 181,149,684	T341A	probably benign	Het
Eml2	T	C	7: 19,196,281	V309A	probably damaging	Het
Fam208a	T	A	14: 27,461,158	F525I	probably damaging	Het
Flnb	C	T	14: 7,905,640	P1130L	possibly damaging	Het
Hivep3	C	A	4: 120,094,888	Q134K	possibly damaging	Het
Kbtbd2	T	A	6: 56,780,026	K242*	probably null	Het
Kel	A	G	6: 41,703,760		probably null	Het
Lcorl	T	A	5: 45,747,204	K177N	probably damaging	Het
Mbd3l2	A	G	9: 18,443,499		probably benign	Het
Mcm3ap	A	G	10: 76,507,479	D1735G	probably damaging	Het
Ms4a1	C	A	19: 11,253,178		probably null	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Mylk	C	A	16: 34,874,150	P193Q	probably benign	Het
Olfr1275	C	T	2: 111,231,197	V199I	probably benign	Het
Olfr1388	G	T	11: 49,443,940	A30S	probably benign	Het
Olfr1390	A	T	11: 49,340,753	T74S	probably damaging	Het
Olfr1424	A	T	19: 12,059,413	F113Y	probably damaging	Het
Olfr339	T	A	2: 36,421,820	C141S	probably damaging	Het
Otogl	C	T	10: 107,827,806	S968N	probably damaging	Het
Oxr1	T	G	15: 41,823,387	V555G	probably damaging	Het
Parp12	T	C	6: 39,111,736	I189V	probably benign	Het
Peg3	T	C	7: 6,712,762	Y103C	probably damaging	Het
Plekhh2	T	C	17: 84,617,999	V1408A	probably benign	Het
Prkacb	T	C	3: 146,745,378	Y204C	probably damaging	Het
Prkch	A	G	12: 73,759,617	E546G	probably damaging	Het
Prss12	C	A	3: 123,447,384	H76N	probably benign	Het
Samd9l	T	A	6: 3,374,750	D837V	probably benign	Het
Slc22a6	G	T	19: 8,618,441	C49F	probably damaging	Het
Slc2a2	T	A	3: 28,721,725	I328N	probably damaging	Het
Slc35f4	T	C	14: 49,318,853	I148V	possibly damaging	Het
Stk32b	A	T	5: 37,448,805		probably null	Het
Tktl2	T	C	8: 66,512,339	I183T	probably damaging	Het
Tmem175	A	C	5: 108,645,979	H325P	probably damaging	Het
Tns3	A	G	11: 8,493,196	V389A	probably damaging	Het
Trappc9	A	T	15: 72,937,162		probably null	Het
Trim28	T	A	7: 13,029,458	F509I	possibly damaging	Het
Vmn1r210	T	A	13: 22,827,543	Q191L	probably benign	Het
Vmn2r24	A	T	6: 123,779,158	D63V	possibly damaging	Het
Zfp536	A	G	7: 37,568,515	L492P	probably damaging	Het
Zfp831	C	A	2: 174,646,740	N1069K	possibly damaging	Het
Zfp943	T	A	17: 21,992,612	H226Q	probably damaging	Het

Other mutations in Rai14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Rai14	APN	15	10599711	splice site	probably benign
IGL01625:Rai14	APN	15	10572374	missense	probably benign	0.30
IGL01925:Rai14	APN	15	10595862	missense	possibly damaging	0.88
IGL02053:Rai14	APN	15	10633156	missense	probably benign	0.00
IGL02531:Rai14	APN	15	10574782	missense	probably damaging	1.00
IGL02748:Rai14	APN	15	10589335	missense	probably benign	0.14
IGL02945:Rai14	APN	15	10574709	missense	probably benign	0.00
PIT4618001:Rai14	UTSW	15	10575156	missense	probably damaging	1.00
R1400:Rai14	UTSW	15	10571548	missense	probably damaging	0.98
R1583:Rai14	UTSW	15	10587916	missense	probably damaging	1.00
R1686:Rai14	UTSW	15	10592196	missense	probably damaging	0.98
R1721:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1867:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1868:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1998:Rai14	UTSW	15	10594981	splice site	probably null
R2118:Rai14	UTSW	15	10575166	missense	probably benign	0.00
R3161:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R4049:Rai14	UTSW	15	10592212	missense	probably benign	0.30
R4611:Rai14	UTSW	15	10592138	missense	probably damaging	1.00
R4760:Rai14	UTSW	15	10575690	missense	possibly damaging	0.60
R4863:Rai14	UTSW	15	10572470	missense	probably damaging	0.99
R5022:Rai14	UTSW	15	10574506	missense	probably damaging	0.96
R5110:Rai14	UTSW	15	10690410	start gained	probably benign
R5410:Rai14	UTSW	15	10574938	missense	probably damaging	1.00
R5643:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5644:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5681:Rai14	UTSW	15	10575120	missense	probably damaging	1.00
R5934:Rai14	UTSW	15	10575159	missense	probably damaging	0.98
R6333:Rai14	UTSW	15	10574936	nonsense	probably null
R6338:Rai14	UTSW	15	10574976	missense	probably damaging	1.00
R7015:Rai14	UTSW	15	10589315	nonsense	probably null
R7155:Rai14	UTSW	15	10595003	missense	possibly damaging	0.53
R7480:Rai14	UTSW	15	10571536	missense	probably benign	0.02
R7574:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7578:Rai14	UTSW	15	10574828	missense	probably benign
R7578:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7597:Rai14	UTSW	15	10574851	missense	possibly damaging	0.94
R7658:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7779:Rai14	UTSW	15	10593026	missense	probably damaging	1.00
R7946:Rai14	UTSW	15	10574201	splice site	probably null
R8171:Rai14	UTSW	15	10633163	missense	probably damaging	1.00
R8195:Rai14	UTSW	15	10575216	missense	probably benign
R8471:Rai14	UTSW	15	10575159	missense	probably benign	0.01
R8485:Rai14	UTSW	15	10575036	missense	probably damaging	1.00
R9075:Rai14	UTSW	15	10589317	missense	probably damaging	1.00
R9287:Rai14	UTSW	15	10592118	missense	probably benign	0.14
R9502:Rai14	UTSW	15	10587861	missense	possibly damaging	0.50
R9603:Rai14	UTSW	15	10595030	nonsense	probably null
R9665:Rai14	UTSW	15	10574717	missense	probably damaging	1.00
R9767:Rai14	UTSW	15	10610041	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCATTGGTCAAACTCCCC -3'
(R):5'- GTTGTTCCCACGGTGAAGTG -3'

Sequencing Primer
(F):5'- TCCCCTTGATGAATAAGTCAGC -3'
(R):5'- AAGGCGGTTTTGAAAGCTGC -3'

Posted On

2018-10-18