Incidental Mutation 'R6864:Trappc9'
ID535834
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6864 (G1)
Quality Score129.008
Status Validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 72937162 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000023276
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089770
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168191
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170633
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
R8683:Trappc9 UTSW 15 73012815 missense probably benign 0.26
R8839:Trappc9 UTSW 15 73058238 nonsense probably null
R8945:Trappc9 UTSW 15 73058096 missense probably benign
R9083:Trappc9 UTSW 15 72736777 nonsense probably null
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- CTACCCTTGGTGGTGAGAAG -3'
(R):5'- AGACTTGTTGACATCCACCATGC -3'

Sequencing Primer
(F):5'- TGAGAAGCTTTGAGGTGACC -3'
(R):5'- CACTCTCCTCCCGTGTGATAGAG -3'
Posted On2018-10-18