Incidental Mutation 'R6864:Trappc9'
ID 535834
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 044964-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6864 (G1)
Quality Score 129.008
Status Validated
Chromosome 15
Chromosomal Location 72461469-72933053 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 72809011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000023276
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089770
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168191
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170633
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,785,879 (GRCm39) T875I probably damaging Het
Anln A T 9: 22,293,545 (GRCm39) S33T probably benign Het
Anxa6 T C 11: 54,877,011 (GRCm39) T541A probably benign Het
Atxn2 C T 5: 121,917,557 (GRCm39) R334W probably damaging Het
AU040320 T A 4: 126,741,612 (GRCm39) V940D probably damaging Het
Bcl2 A T 1: 106,471,011 (GRCm39) Y232N probably damaging Het
Bmp7 A G 2: 172,781,855 (GRCm39) V3A probably benign Het
Calr A T 8: 85,571,557 (GRCm39) H145Q probably damaging Het
Camta2 T A 11: 70,562,792 (GRCm39) T976S probably benign Het
Ccnk G A 12: 108,168,473 (GRCm39) probably benign Het
Cntln T C 4: 85,015,029 (GRCm39) S1107P probably damaging Het
Cradd T C 10: 95,011,789 (GRCm39) D117G probably damaging Het
Dcaf7 C T 11: 105,937,647 (GRCm39) T90I probably damaging Het
Defb30 T A 14: 63,273,552 (GRCm39) probably null Het
Dock4 T A 12: 40,795,745 (GRCm39) I854N probably damaging Het
Dym T A 18: 75,189,809 (GRCm39) Y132* probably null Het
Eef1a2 T C 2: 180,791,477 (GRCm39) T341A probably benign Het
Eml2 T C 7: 18,930,206 (GRCm39) V309A probably damaging Het
Flnb C T 14: 7,905,640 (GRCm38) P1130L possibly damaging Het
Hivep3 C A 4: 119,952,085 (GRCm39) Q134K possibly damaging Het
Kbtbd2 T A 6: 56,757,011 (GRCm39) K242* probably null Het
Kel A G 6: 41,680,694 (GRCm39) probably null Het
Lcorl T A 5: 45,904,546 (GRCm39) K177N probably damaging Het
Mbd3l2 A G 9: 18,354,795 (GRCm39) probably benign Het
Mcm3ap A G 10: 76,343,313 (GRCm39) D1735G probably damaging Het
Ms4a1 C A 19: 11,230,542 (GRCm39) probably null Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Mylk C A 16: 34,694,520 (GRCm39) P193Q probably benign Het
Or1j11 T A 2: 36,311,832 (GRCm39) C141S probably damaging Het
Or2y16 G T 11: 49,334,767 (GRCm39) A30S probably benign Het
Or2y17 A T 11: 49,231,580 (GRCm39) T74S probably damaging Het
Or4d10b A T 19: 12,036,777 (GRCm39) F113Y probably damaging Het
Or4f52 C T 2: 111,061,542 (GRCm39) V199I probably benign Het
Otogl C T 10: 107,663,667 (GRCm39) S968N probably damaging Het
Oxr1 T G 15: 41,686,783 (GRCm39) V555G probably damaging Het
Parp12 T C 6: 39,088,670 (GRCm39) I189V probably benign Het
Peg3 T C 7: 6,715,761 (GRCm39) Y103C probably damaging Het
Plekhh2 T C 17: 84,925,427 (GRCm39) V1408A probably benign Het
Prkacb T C 3: 146,451,133 (GRCm39) Y204C probably damaging Het
Prkch A G 12: 73,806,391 (GRCm39) E546G probably damaging Het
Prss12 C A 3: 123,241,033 (GRCm39) H76N probably benign Het
Rai14 G T 15: 10,633,254 (GRCm39) S45R possibly damaging Het
Samd9l T A 6: 3,374,750 (GRCm39) D837V probably benign Het
Slc22a6 G T 19: 8,595,805 (GRCm39) C49F probably damaging Het
Slc2a2 T A 3: 28,775,874 (GRCm39) I328N probably damaging Het
Slc35f4 T C 14: 49,556,310 (GRCm39) I148V possibly damaging Het
Stk32b A T 5: 37,606,149 (GRCm39) probably null Het
Tasor T A 14: 27,183,115 (GRCm39) F525I probably damaging Het
Tktl2 T C 8: 66,964,991 (GRCm39) I183T probably damaging Het
Tmem175 A C 5: 108,793,845 (GRCm39) H325P probably damaging Het
Tns3 A G 11: 8,443,196 (GRCm39) V389A probably damaging Het
Trim28 T A 7: 12,763,385 (GRCm39) F509I possibly damaging Het
Vmn1r210 T A 13: 23,011,713 (GRCm39) Q191L probably benign Het
Vmn2r24 A T 6: 123,756,117 (GRCm39) D63V possibly damaging Het
Zfp536 A G 7: 37,267,940 (GRCm39) L492P probably damaging Het
Zfp831 C A 2: 174,488,533 (GRCm39) N1069K possibly damaging Het
Zfp943 T A 17: 22,211,593 (GRCm39) H226Q probably damaging Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 72,897,875 (GRCm39) missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72,808,858 (GRCm39) missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72,462,002 (GRCm39) missense probably benign 0.31
IGL01521:Trappc9 APN 15 72,924,016 (GRCm39) missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72,817,971 (GRCm39) missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72,871,841 (GRCm39) missense probably damaging 1.00
IGL02214:Trappc9 APN 15 72,884,731 (GRCm39) nonsense probably null
IGL02693:Trappc9 APN 15 72,835,542 (GRCm39) splice site probably benign
IGL03229:Trappc9 APN 15 72,930,305 (GRCm39) missense probably damaging 1.00
basilio UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
Boomboom UTSW 15 72,608,718 (GRCm39) nonsense probably null
bronto UTSW 15 72,930,087 (GRCm39) nonsense probably null
Earl UTSW 15 72,608,626 (GRCm39) nonsense probably null
Sotto_aceto UTSW 15 72,557,188 (GRCm39) missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72,824,931 (GRCm39) missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 72,903,447 (GRCm39) frame shift probably null
PIT4519001:Trappc9 UTSW 15 72,824,943 (GRCm39) missense probably benign
R0001:Trappc9 UTSW 15 72,835,511 (GRCm39) missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72,894,929 (GRCm38) intron probably benign
R0745:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0747:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72,824,981 (GRCm39) splice site probably benign
R0816:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0819:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0820:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72,461,956 (GRCm39) missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72,871,823 (GRCm39) missense probably damaging 0.99
R1119:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1266:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1453:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1454:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72,565,397 (GRCm39) nonsense probably null
R1543:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1563:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1565:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72,808,958 (GRCm39) nonsense probably null
R1712:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1756:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1789:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1978:Trappc9 UTSW 15 72,871,874 (GRCm39) missense probably damaging 1.00
R2001:Trappc9 UTSW 15 72,929,885 (GRCm39) missense probably damaging 0.99
R2312:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R2334:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R2926:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3123:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3124:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3125:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3813:Trappc9 UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
R4012:Trappc9 UTSW 15 72,903,472 (GRCm39) missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72,813,796 (GRCm39) missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72,462,641 (GRCm39) missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72,808,916 (GRCm39) missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72,808,909 (GRCm39) missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72,808,905 (GRCm39) missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72,808,905 (GRCm39) missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72,785,215 (GRCm39) intron probably benign
R5128:Trappc9 UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
R5228:Trappc9 UTSW 15 72,929,844 (GRCm39) missense probably damaging 1.00
R5362:Trappc9 UTSW 15 72,930,066 (GRCm39) missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72,557,188 (GRCm39) missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72,797,379 (GRCm39) missense probably benign 0.43
R6032:Trappc9 UTSW 15 72,797,379 (GRCm39) missense probably benign 0.43
R6154:Trappc9 UTSW 15 72,929,930 (GRCm39) missense probably benign 0.03
R6372:Trappc9 UTSW 15 72,461,923 (GRCm39) missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72,461,993 (GRCm39) missense possibly damaging 0.55
R6893:Trappc9 UTSW 15 72,797,499 (GRCm39) missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72,565,468 (GRCm39) missense probably benign 0.00
R7276:Trappc9 UTSW 15 72,924,119 (GRCm39) missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72,608,718 (GRCm39) nonsense probably null
R8260:Trappc9 UTSW 15 72,813,758 (GRCm39) nonsense probably null
R8399:Trappc9 UTSW 15 72,924,131 (GRCm39) missense probably damaging 1.00
R8683:Trappc9 UTSW 15 72,884,664 (GRCm39) missense probably benign 0.26
R8839:Trappc9 UTSW 15 72,930,087 (GRCm39) nonsense probably null
R8945:Trappc9 UTSW 15 72,929,945 (GRCm39) missense probably benign
R9083:Trappc9 UTSW 15 72,608,626 (GRCm39) nonsense probably null
R9323:Trappc9 UTSW 15 72,565,431 (GRCm39) missense probably benign 0.41
R9329:Trappc9 UTSW 15 72,673,202 (GRCm39) missense unknown
R9366:Trappc9 UTSW 15 72,808,937 (GRCm39) missense probably benign
R9723:Trappc9 UTSW 15 72,461,963 (GRCm39) missense possibly damaging 0.87
RF008:Trappc9 UTSW 15 72,673,138 (GRCm39) small insertion probably benign
RF009:Trappc9 UTSW 15 72,673,136 (GRCm39) small insertion probably benign
RF014:Trappc9 UTSW 15 72,673,132 (GRCm39) small insertion probably benign
RF016:Trappc9 UTSW 15 72,673,138 (GRCm39) small insertion probably benign
RF023:Trappc9 UTSW 15 72,673,180 (GRCm39) small insertion probably benign
RF023:Trappc9 UTSW 15 72,673,173 (GRCm39) small insertion probably benign
RF028:Trappc9 UTSW 15 72,673,139 (GRCm39) small insertion probably benign
RF029:Trappc9 UTSW 15 72,673,172 (GRCm39) small insertion probably benign
RF030:Trappc9 UTSW 15 72,673,174 (GRCm39) small insertion probably benign
RF034:Trappc9 UTSW 15 72,673,147 (GRCm39) small insertion probably benign
RF036:Trappc9 UTSW 15 72,673,169 (GRCm39) small insertion probably benign
RF038:Trappc9 UTSW 15 72,673,172 (GRCm39) small insertion probably benign
RF040:Trappc9 UTSW 15 72,673,141 (GRCm39) small insertion probably benign
RF042:Trappc9 UTSW 15 72,673,132 (GRCm39) small insertion probably benign
RF043:Trappc9 UTSW 15 72,673,154 (GRCm39) small insertion probably benign
RF049:Trappc9 UTSW 15 72,673,150 (GRCm39) small insertion probably benign
RF049:Trappc9 UTSW 15 72,673,155 (GRCm39) small insertion probably benign
RF053:Trappc9 UTSW 15 72,673,177 (GRCm39) small insertion probably benign
RF057:Trappc9 UTSW 15 72,673,144 (GRCm39) small insertion probably benign
RF063:Trappc9 UTSW 15 72,673,173 (GRCm39) small insertion probably benign
RF063:Trappc9 UTSW 15 72,673,169 (GRCm39) small insertion probably benign
Z1177:Trappc9 UTSW 15 72,924,011 (GRCm39) missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- CTACCCTTGGTGGTGAGAAG -3'
(R):5'- AGACTTGTTGACATCCACCATGC -3'

Sequencing Primer
(F):5'- TGAGAAGCTTTGAGGTGACC -3'
(R):5'- CACTCTCCTCCCGTGTGATAGAG -3'
Posted On 2018-10-18