Incidental Mutation 'R6864:Mylk'
ID 535835
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 044964-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6864 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34694520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 193 (P193Q)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: P193Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: P193Q

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,785,879 (GRCm39) T875I probably damaging Het
Anln A T 9: 22,293,545 (GRCm39) S33T probably benign Het
Anxa6 T C 11: 54,877,011 (GRCm39) T541A probably benign Het
Atxn2 C T 5: 121,917,557 (GRCm39) R334W probably damaging Het
AU040320 T A 4: 126,741,612 (GRCm39) V940D probably damaging Het
Bcl2 A T 1: 106,471,011 (GRCm39) Y232N probably damaging Het
Bmp7 A G 2: 172,781,855 (GRCm39) V3A probably benign Het
Calr A T 8: 85,571,557 (GRCm39) H145Q probably damaging Het
Camta2 T A 11: 70,562,792 (GRCm39) T976S probably benign Het
Ccnk G A 12: 108,168,473 (GRCm39) probably benign Het
Cntln T C 4: 85,015,029 (GRCm39) S1107P probably damaging Het
Cradd T C 10: 95,011,789 (GRCm39) D117G probably damaging Het
Dcaf7 C T 11: 105,937,647 (GRCm39) T90I probably damaging Het
Defb30 T A 14: 63,273,552 (GRCm39) probably null Het
Dock4 T A 12: 40,795,745 (GRCm39) I854N probably damaging Het
Dym T A 18: 75,189,809 (GRCm39) Y132* probably null Het
Eef1a2 T C 2: 180,791,477 (GRCm39) T341A probably benign Het
Eml2 T C 7: 18,930,206 (GRCm39) V309A probably damaging Het
Flnb C T 14: 7,905,640 (GRCm38) P1130L possibly damaging Het
Hivep3 C A 4: 119,952,085 (GRCm39) Q134K possibly damaging Het
Kbtbd2 T A 6: 56,757,011 (GRCm39) K242* probably null Het
Kel A G 6: 41,680,694 (GRCm39) probably null Het
Lcorl T A 5: 45,904,546 (GRCm39) K177N probably damaging Het
Mbd3l2 A G 9: 18,354,795 (GRCm39) probably benign Het
Mcm3ap A G 10: 76,343,313 (GRCm39) D1735G probably damaging Het
Ms4a1 C A 19: 11,230,542 (GRCm39) probably null Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Or1j11 T A 2: 36,311,832 (GRCm39) C141S probably damaging Het
Or2y16 G T 11: 49,334,767 (GRCm39) A30S probably benign Het
Or2y17 A T 11: 49,231,580 (GRCm39) T74S probably damaging Het
Or4d10b A T 19: 12,036,777 (GRCm39) F113Y probably damaging Het
Or4f52 C T 2: 111,061,542 (GRCm39) V199I probably benign Het
Otogl C T 10: 107,663,667 (GRCm39) S968N probably damaging Het
Oxr1 T G 15: 41,686,783 (GRCm39) V555G probably damaging Het
Parp12 T C 6: 39,088,670 (GRCm39) I189V probably benign Het
Peg3 T C 7: 6,715,761 (GRCm39) Y103C probably damaging Het
Plekhh2 T C 17: 84,925,427 (GRCm39) V1408A probably benign Het
Prkacb T C 3: 146,451,133 (GRCm39) Y204C probably damaging Het
Prkch A G 12: 73,806,391 (GRCm39) E546G probably damaging Het
Prss12 C A 3: 123,241,033 (GRCm39) H76N probably benign Het
Rai14 G T 15: 10,633,254 (GRCm39) S45R possibly damaging Het
Samd9l T A 6: 3,374,750 (GRCm39) D837V probably benign Het
Slc22a6 G T 19: 8,595,805 (GRCm39) C49F probably damaging Het
Slc2a2 T A 3: 28,775,874 (GRCm39) I328N probably damaging Het
Slc35f4 T C 14: 49,556,310 (GRCm39) I148V possibly damaging Het
Stk32b A T 5: 37,606,149 (GRCm39) probably null Het
Tasor T A 14: 27,183,115 (GRCm39) F525I probably damaging Het
Tktl2 T C 8: 66,964,991 (GRCm39) I183T probably damaging Het
Tmem175 A C 5: 108,793,845 (GRCm39) H325P probably damaging Het
Tns3 A G 11: 8,443,196 (GRCm39) V389A probably damaging Het
Trappc9 A T 15: 72,809,011 (GRCm39) probably null Het
Trim28 T A 7: 12,763,385 (GRCm39) F509I possibly damaging Het
Vmn1r210 T A 13: 23,011,713 (GRCm39) Q191L probably benign Het
Vmn2r24 A T 6: 123,756,117 (GRCm39) D63V possibly damaging Het
Zfp536 A G 7: 37,267,940 (GRCm39) L492P probably damaging Het
Zfp831 C A 2: 174,488,533 (GRCm39) N1069K possibly damaging Het
Zfp943 T A 17: 22,211,593 (GRCm39) H226Q probably damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCAAATGGTTTCTGAGTGGCTATC -3'
(R):5'- AGAACACCATGGTCTGAGTGAC -3'

Sequencing Primer
(F):5'- AGTGGCTATCCAGTCTAAATGG -3'
(R):5'- TCTGAGTGACAGCAGGGGAC -3'
Posted On 2018-10-18