Mutagenetix > Incidental Mutations

Incidental Mutation 'R6864:Mylk'

535835

Institutional Source

Beutler Lab

Gene Symbol

Mylk

Ensembl Gene

ENSMUSG00000022836

Gene Name

myosin, light polypeptide kinase

Synonyms

Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34745210-35002420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 34874150 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 193 (P193Q)

Ref Sequence

ENSEMBL: ENSMUSP00000023538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023538]

Predicted Effect

probably benign
Transcript: ENSMUST00000023538
AA Change: P193Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: P193Q

Domain	Start	End	E-Value	Type
IGc2	54	122	9.05e-11	SMART
IGc2	177	244	3.94e-11	SMART
Pfam:23ISL	255	409	3.6e-60	PFAM
IGc2	423	491	1.55e-9	SMART
IGc2	523	587	3.32e-18	SMART
IGc2	632	699	6.02e-7	SMART
IGc2	730	798	1.36e-5	SMART
low complexity region	827	844	N/A	INTRINSIC
IGc2	1141	1208	2.42e-11	SMART
low complexity region	1251	1269	N/A	INTRINSIC
IG	1275	1359	4.56e-7	SMART
FN3	1362	1444	2.33e-11	SMART
low complexity region	1457	1479	N/A	INTRINSIC
S_TKc	1495	1750	4.23e-95	SMART
IGc2	1852	1920	5.92e-15	SMART
low complexity region	1934	1950	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	C	T	17: 57,478,879	T875I	probably damaging	Het
Anln	A	T	9: 22,382,249	S33T	probably benign	Het
Anxa6	T	C	11: 54,986,185	T541A	probably benign	Het
Atxn2	C	T	5: 121,779,494	R334W	probably damaging	Het
AU040320	T	A	4: 126,847,819	V940D	probably damaging	Het
Bcl2	A	T	1: 106,543,281	Y232N	probably damaging	Het
Bmp7	A	G	2: 172,940,062	V3A	probably benign	Het
Calr	A	T	8: 84,844,928	H145Q	probably damaging	Het
Camta2	T	A	11: 70,671,966	T976S	probably benign	Het
Ccnk	G	A	12: 108,202,214		probably benign	Het
Cntln	T	C	4: 85,096,792	S1107P	probably damaging	Het
Cradd	T	C	10: 95,175,927	D117G	probably damaging	Het
Dcaf7	C	T	11: 106,046,821	T90I	probably damaging	Het
Defb30	T	A	14: 63,036,103		probably null	Het
Dock4	T	A	12: 40,745,746	I854N	probably damaging	Het
Dym	T	A	18: 75,056,738	Y132*	probably null	Het
Eef1a2	T	C	2: 181,149,684	T341A	probably benign	Het
Eml2	T	C	7: 19,196,281	V309A	probably damaging	Het
Fam208a	T	A	14: 27,461,158	F525I	probably damaging	Het
Flnb	C	T	14: 7,905,640	P1130L	possibly damaging	Het
Hivep3	C	A	4: 120,094,888	Q134K	possibly damaging	Het
Kbtbd2	T	A	6: 56,780,026	K242*	probably null	Het
Kel	A	G	6: 41,703,760		probably null	Het
Lcorl	T	A	5: 45,747,204	K177N	probably damaging	Het
Mbd3l2	A	G	9: 18,443,499		probably benign	Het
Mcm3ap	A	G	10: 76,507,479	D1735G	probably damaging	Het
Ms4a1	C	A	19: 11,253,178		probably null	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Olfr1275	C	T	2: 111,231,197	V199I	probably benign	Het
Olfr1388	G	T	11: 49,443,940	A30S	probably benign	Het
Olfr1390	A	T	11: 49,340,753	T74S	probably damaging	Het
Olfr1424	A	T	19: 12,059,413	F113Y	probably damaging	Het
Olfr339	T	A	2: 36,421,820	C141S	probably damaging	Het
Otogl	C	T	10: 107,827,806	S968N	probably damaging	Het
Oxr1	T	G	15: 41,823,387	V555G	probably damaging	Het
Parp12	T	C	6: 39,111,736	I189V	probably benign	Het
Peg3	T	C	7: 6,712,762	Y103C	probably damaging	Het
Plekhh2	T	C	17: 84,617,999	V1408A	probably benign	Het
Prkacb	T	C	3: 146,745,378	Y204C	probably damaging	Het
Prkch	A	G	12: 73,759,617	E546G	probably damaging	Het
Prss12	C	A	3: 123,447,384	H76N	probably benign	Het
Rai14	G	T	15: 10,633,168	S45R	possibly damaging	Het
Samd9l	T	A	6: 3,374,750	D837V	probably benign	Het
Slc22a6	G	T	19: 8,618,441	C49F	probably damaging	Het
Slc2a2	T	A	3: 28,721,725	I328N	probably damaging	Het
Slc35f4	T	C	14: 49,318,853	I148V	possibly damaging	Het
Stk32b	A	T	5: 37,448,805		probably null	Het
Tktl2	T	C	8: 66,512,339	I183T	probably damaging	Het
Tmem175	A	C	5: 108,645,979	H325P	probably damaging	Het
Tns3	A	G	11: 8,493,196	V389A	probably damaging	Het
Trappc9	A	T	15: 72,937,162		probably null	Het
Trim28	T	A	7: 13,029,458	F509I	possibly damaging	Het
Vmn1r210	T	A	13: 22,827,543	Q191L	probably benign	Het
Vmn2r24	A	T	6: 123,779,158	D63V	possibly damaging	Het
Zfp536	A	G	7: 37,568,515	L492P	probably damaging	Het
Zfp831	C	A	2: 174,646,740	N1069K	possibly damaging	Het
Zfp943	T	A	17: 21,992,612	H226Q	probably damaging	Het

Other mutations in Mylk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Mylk	APN	16	34938952	missense	probably benign	0.36
IGL01386:Mylk	APN	16	34971240	critical splice acceptor site	probably null
IGL01684:Mylk	APN	16	34971940	missense	possibly damaging	0.55
IGL01884:Mylk	APN	16	34988877	splice site	probably benign
IGL02079:Mylk	APN	16	34860631	missense	possibly damaging	0.87
IGL02104:Mylk	APN	16	34815435	missense	probably benign	0.06
IGL02624:Mylk	APN	16	34929896	missense	probably benign	0.29
IGL02756:Mylk	APN	16	34963646	missense	probably benign	0.42
IGL02794:Mylk	APN	16	34986541	missense	probably benign	0.21
IGL02833:Mylk	APN	16	34914900	missense	probably benign	0.01
IGL02946:Mylk	APN	16	34921788	missense	probably benign	0.10
IGL03012:Mylk	APN	16	34952781	missense	probably benign	0.03
IGL03093:Mylk	APN	16	34912192	missense	possibly damaging	0.62
IGL03272:Mylk	APN	16	34979189	missense	probably benign	0.09
billy	UTSW	16	34875620	missense	probably damaging	0.97
brutus	UTSW	16	34953695	missense	probably benign	0.12
Club	UTSW	16	34912275	nonsense	probably null
popeye	UTSW	16	34963577	missense	probably benign	0.29
F5770:Mylk	UTSW	16	34995204	critical splice donor site	probably null
P4717OSA:Mylk	UTSW	16	34977113	splice site	probably benign
PIT4382001:Mylk	UTSW	16	34875642	missense	probably damaging	0.99
R0131:Mylk	UTSW	16	34875504	missense	probably benign	0.03
R0309:Mylk	UTSW	16	34912297	splice site	probably benign
R0358:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0381:Mylk	UTSW	16	34784974	splice site	probably null
R0390:Mylk	UTSW	16	34875620	missense	probably damaging	0.97
R0413:Mylk	UTSW	16	34921944	missense	probably benign	0.01
R0536:Mylk	UTSW	16	35000387	missense	possibly damaging	0.95
R0544:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0545:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0546:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0547:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0548:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0627:Mylk	UTSW	16	35000429	missense	probably damaging	1.00
R0726:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0755:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0782:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0783:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0784:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1136:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R1170:Mylk	UTSW	16	34874039	missense	probably benign	0.20
R1222:Mylk	UTSW	16	34860652	missense	probably benign	0.12
R1445:Mylk	UTSW	16	34815465	missense	possibly damaging	0.57
R1583:Mylk	UTSW	16	34875586	missense	probably benign	0.29
R1618:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1643:Mylk	UTSW	16	34875635	missense	probably benign	0.03
R1702:Mylk	UTSW	16	34921944	missense	probably benign	0.00
R1776:Mylk	UTSW	16	34952782	missense	probably benign	0.16
R1865:Mylk	UTSW	16	34912230	missense	probably benign	0.03
R1975:Mylk	UTSW	16	34880303	splice site	probably null
R2016:Mylk	UTSW	16	34996817	missense	probably damaging	1.00
R2045:Mylk	UTSW	16	34953653	missense	probably benign	0.29
R2134:Mylk	UTSW	16	34986476	missense	probably benign	0.13
R3547:Mylk	UTSW	16	34880168	missense	possibly damaging	0.61
R3844:Mylk	UTSW	16	34921877	missense	probably benign	0.01
R4003:Mylk	UTSW	16	34963577	missense	probably benign	0.29
R4396:Mylk	UTSW	16	34912275	nonsense	probably null
R4470:Mylk	UTSW	16	34912152	missense	probably benign	0.09
R4507:Mylk	UTSW	16	34953695	missense	probably benign	0.12
R4700:Mylk	UTSW	16	34922435	missense	probably benign	0.16
R4751:Mylk	UTSW	16	34879169	missense	probably benign	0.29
R4815:Mylk	UTSW	16	34894925	missense	probably damaging	0.97
R4832:Mylk	UTSW	16	34922367	missense	probably benign	0.36
R4872:Mylk	UTSW	16	34914990	missense	possibly damaging	0.89
R4953:Mylk	UTSW	16	34988961	missense	probably damaging	1.00
R4969:Mylk	UTSW	16	34971440	missense	probably damaging	0.96
R5009:Mylk	UTSW	16	34899507	missense	probably benign	0.39
R5130:Mylk	UTSW	16	34988997	missense	probably damaging	1.00
R5173:Mylk	UTSW	16	34977013	missense	probably benign	0.40
R5195:Mylk	UTSW	16	34979215	missense	probably damaging	1.00
R5209:Mylk	UTSW	16	34922625	missense	possibly damaging	0.55
R5311:Mylk	UTSW	16	34921757	missense	probably benign	0.01
R5418:Mylk	UTSW	16	34912230	missense	probably benign	0.02
R5481:Mylk	UTSW	16	34921604	missense	probably benign	0.09
R5590:Mylk	UTSW	16	34879352	missense	probably benign	0.29
R5603:Mylk	UTSW	16	34956492	missense	probably benign	0.06
R5823:Mylk	UTSW	16	34894947	critical splice donor site	probably null
R6290:Mylk	UTSW	16	34894843	missense	probably benign	0.39
R6351:Mylk	UTSW	16	34921971	missense	probably benign	0.01
R6365:Mylk	UTSW	16	34860591	missense	probably benign	0.12
R6490:Mylk	UTSW	16	34929867	missense	possibly damaging	0.74
R6723:Mylk	UTSW	16	34929888	missense	possibly damaging	0.74
R6908:Mylk	UTSW	16	34880273	missense	probably benign	0.18
R6949:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R7018:Mylk	UTSW	16	35000426	missense	possibly damaging	0.88
R7035:Mylk	UTSW	16	34976982	missense	possibly damaging	0.89
R7162:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7236:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7269:Mylk	UTSW	16	34785011	missense	probably damaging	0.96
R7475:Mylk	UTSW	16	34914076	splice site	probably null
R7525:Mylk	UTSW	16	34988987	missense	probably benign	0.06
R7587:Mylk	UTSW	16	34922517	missense	probably benign	0.29
R7607:Mylk	UTSW	16	34894814	missense	probably benign	0.09
R7616:Mylk	UTSW	16	34879557	missense	probably damaging	0.97
R7647:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7648:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7764:Mylk	UTSW	16	34922183	missense	probably benign	0.16
R7890:Mylk	UTSW	16	34963648	nonsense	probably null
R7892:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7893:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R8065:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8067:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8143:Mylk	UTSW	16	34914155	missense	possibly damaging	0.87
R8210:Mylk	UTSW	16	35000351	missense	probably damaging	1.00
R8271:Mylk	UTSW	16	34922579	missense	probably damaging	0.97
R8540:Mylk	UTSW	16	34929887	missense	possibly damaging	0.87
RF001:Mylk	UTSW	16	34879371	missense	probably benign	0.03
V7580:Mylk	UTSW	16	34995204	critical splice donor site	probably null
V7583:Mylk	UTSW	16	34995204	critical splice donor site	probably null
X0065:Mylk	UTSW	16	35000441	missense	probably damaging	1.00
Z1177:Mylk	UTSW	16	34922651	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TCAAATGGTTTCTGAGTGGCTATC -3'
(R):5'- AGAACACCATGGTCTGAGTGAC -3'

Sequencing Primer
(F):5'- AGTGGCTATCCAGTCTAAATGG -3'
(R):5'- TCTGAGTGACAGCAGGGGAC -3'

Posted On

2018-10-18