Incidental Mutation 'R6864:Zfp943'
ID535836
Institutional Source Beutler Lab
Gene Symbol Zfp943
Ensembl Gene ENSMUSG00000053347
Gene Namezinc finger prtoein 943
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location21962552-22071168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21992612 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 226 (H226Q)
Ref Sequence ENSEMBL: ENSMUSP00000059554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055349] [ENSMUST00000153985] [ENSMUST00000174015]
Predicted Effect probably damaging
Transcript: ENSMUST00000055349
AA Change: H226Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059554
Gene: ENSMUSG00000053347
AA Change: H226Q

DomainStartEndE-ValueType
KRAB 13 72 2.62e-18 SMART
ZnF_C2H2 180 202 1.6e-4 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 236 258 1.13e-4 SMART
ZnF_C2H2 264 286 1.03e-2 SMART
ZnF_C2H2 292 314 2.24e-3 SMART
ZnF_C2H2 320 342 9.58e-3 SMART
ZnF_C2H2 348 370 5.67e-5 SMART
ZnF_C2H2 376 398 4.54e-4 SMART
ZnF_C2H2 404 426 2.15e-5 SMART
ZnF_C2H2 432 454 5.59e-4 SMART
ZnF_C2H2 460 482 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153985
SMART Domains Protein: ENSMUSP00000115817
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 73 3.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174015
SMART Domains Protein: ENSMUSP00000133735
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 60 3.79e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Other mutations in Zfp943
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03101:Zfp943 APN 17 21992175 missense probably damaging 1.00
R0019:Zfp943 UTSW 17 21992089 intron probably benign
R0827:Zfp943 UTSW 17 21992090 critical splice acceptor site probably null
R1824:Zfp943 UTSW 17 21992380 missense probably benign 0.32
R1958:Zfp943 UTSW 17 21992998 missense probably damaging 0.99
R2174:Zfp943 UTSW 17 21992823 missense probably damaging 1.00
R3790:Zfp943 UTSW 17 21992422 missense possibly damaging 0.81
R4093:Zfp943 UTSW 17 21992982 missense probably damaging 1.00
R4094:Zfp943 UTSW 17 21992982 missense probably damaging 1.00
R4352:Zfp943 UTSW 17 21993123 missense probably damaging 0.98
R4677:Zfp943 UTSW 17 21993195 missense probably benign 0.17
R4735:Zfp943 UTSW 17 21992410 missense probably benign 0.03
R5201:Zfp943 UTSW 17 21992813 missense probably damaging 1.00
R5492:Zfp943 UTSW 17 21993075 missense probably damaging 1.00
R5642:Zfp943 UTSW 17 21992832 missense probably damaging 1.00
R6031:Zfp943 UTSW 17 21993376 missense probably benign
R6031:Zfp943 UTSW 17 21993376 missense probably benign
R6667:Zfp943 UTSW 17 21992908 missense probably damaging 1.00
R6976:Zfp943 UTSW 17 21990941 missense possibly damaging 0.47
R7837:Zfp943 UTSW 17 21992365 missense probably benign 0.39
R7920:Zfp943 UTSW 17 21992365 missense probably benign 0.39
Z1176:Zfp943 UTSW 17 21992965 missense probably damaging 1.00
Z1177:Zfp943 UTSW 17 21988082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTTGACACTAAACATGAACTC -3'
(R):5'- CAGTACATTTGTAAGGTTTCTCTCCTG -3'

Sequencing Primer
(F):5'- CTCATGCTTAAACAAACCAATAGTG -3'
(R):5'- GTAAGGTTTCTCTCCTGTATGAATTC -3'
Posted On2018-10-18