Incidental Mutation 'R6865:Fga'
ID 535852
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Name fibrinogen alpha chain
Synonyms Fib, ENSMUSG00000059807
MMRRC Submission 045027-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.387) question?
Stock # R6865 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 82933460-82940934 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82938848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 408 (C408S)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
AlphaFold E9PV24
Predicted Effect probably damaging
Transcript: ENSMUST00000029630
AA Change: C408S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: C408S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166581
AA Change: C408S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: C408S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T A 13: 4,320,212 (GRCm39) M293L possibly damaging Het
Ankrd11 T C 8: 123,621,683 (GRCm39) D723G probably benign Het
Ankrd26 T C 6: 118,500,442 (GRCm39) R1010G possibly damaging Het
Apob G A 12: 8,058,847 (GRCm39) R2410H probably benign Het
Auh T C 13: 52,992,165 (GRCm39) D275G probably damaging Het
Card10 G T 15: 78,686,822 (GRCm39) D47E possibly damaging Het
Ccdc141 C T 2: 76,859,579 (GRCm39) probably null Het
Cfap206 T C 4: 34,714,448 (GRCm39) Y416C possibly damaging Het
Chuk A T 19: 44,075,354 (GRCm39) Y500* probably null Het
Cop1 T A 1: 159,136,524 (GRCm39) D536E probably damaging Het
Crh G C 3: 19,748,304 (GRCm39) P113A possibly damaging Het
Ddx54 T G 5: 120,759,892 (GRCm39) probably null Het
Efcab7 T C 4: 99,769,793 (GRCm39) S127P probably damaging Het
Efhc1 A G 1: 21,030,442 (GRCm39) Y125C probably damaging Het
Flot2 T C 11: 77,940,318 (GRCm39) S22P probably benign Het
Fndc1 T A 17: 7,991,672 (GRCm39) T675S unknown Het
Foxc1 A G 13: 31,992,836 (GRCm39) D549G unknown Het
Gldc T C 19: 30,111,162 (GRCm39) N538S possibly damaging Het
Grk4 T G 5: 34,888,894 (GRCm39) V346G probably damaging Het
Gucy2c T C 6: 136,747,127 (GRCm39) R111G probably benign Het
Heatr6 C T 11: 83,659,966 (GRCm39) H504Y probably damaging Het
Lrp5 A T 19: 3,670,013 (GRCm39) probably null Het
Msrb1 T C 17: 24,955,685 (GRCm39) S2P possibly damaging Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Myo3a A G 2: 22,464,313 (GRCm39) I185V probably benign Het
Myo5c T C 9: 75,176,878 (GRCm39) S608P probably benign Het
Nek6 A G 2: 38,459,678 (GRCm39) I174V probably benign Het
Nmt2 T C 2: 3,315,766 (GRCm39) V252A probably damaging Het
Nudt9 G T 5: 104,207,545 (GRCm39) R179M probably damaging Het
Nwd1 T C 8: 73,383,690 (GRCm39) V29A possibly damaging Het
Olah T C 2: 3,343,964 (GRCm39) D216G possibly damaging Het
Or13c7b T C 4: 43,821,346 (GRCm39) N5S probably benign Het
Or52n2 T C 7: 104,542,719 (GRCm39) I39V probably benign Het
Parp12 T C 6: 39,088,670 (GRCm39) I189V probably benign Het
Pkd1 T C 17: 24,795,461 (GRCm39) V2318A probably benign Het
Pknox1 T A 17: 31,807,534 (GRCm39) M51K probably damaging Het
Ppp1r12a C T 10: 108,098,242 (GRCm39) R321* probably null Het
Pxdn A G 12: 30,064,582 (GRCm39) probably null Het
Rab44 A T 17: 29,358,201 (GRCm39) I130F probably benign Het
Rnf130 T C 11: 49,962,091 (GRCm39) I179T probably damaging Het
Slc22a28 A T 19: 8,041,856 (GRCm39) C450* probably null Het
Slco1c1 A T 6: 141,485,778 (GRCm39) Y136F probably damaging Het
Synj2 C T 17: 6,067,844 (GRCm39) Q106* probably null Het
Uckl1 T C 2: 181,216,286 (GRCm39) N138S probably damaging Het
Usp19 G T 9: 108,376,018 (GRCm39) E203* probably null Het
Vdr A G 15: 97,755,386 (GRCm39) I379T probably damaging Het
Zfp503 C A 14: 22,036,101 (GRCm39) G272C probably damaging Het
Zfyve9 T C 4: 108,501,558 (GRCm39) N1218S possibly damaging Het
Zzz3 T A 3: 152,133,690 (GRCm39) D249E probably benign Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 82,938,981 (GRCm39) missense probably damaging 1.00
IGL00478:Fga APN 3 82,935,951 (GRCm39) missense probably benign 0.00
IGL00587:Fga APN 3 82,937,596 (GRCm39) missense possibly damaging 0.62
IGL01289:Fga APN 3 82,938,552 (GRCm39) missense possibly damaging 0.85
IGL01323:Fga APN 3 82,937,518 (GRCm39) missense probably damaging 0.99
IGL01369:Fga APN 3 82,937,507 (GRCm39) missense probably benign 0.00
IGL01409:Fga APN 3 82,940,059 (GRCm39) missense probably damaging 1.00
IGL01541:Fga APN 3 82,940,014 (GRCm39) missense probably damaging 1.00
IGL01633:Fga APN 3 82,937,606 (GRCm39) missense possibly damaging 0.89
IGL01966:Fga APN 3 82,936,461 (GRCm39) missense probably damaging 0.97
IGL02651:Fga APN 3 82,935,841 (GRCm39) missense probably benign 0.00
IGL02822:Fga APN 3 82,938,789 (GRCm39) missense probably damaging 1.00
IGL03003:Fga APN 3 82,940,037 (GRCm39) missense probably damaging 1.00
R0336:Fga UTSW 3 82,938,164 (GRCm39) missense probably damaging 1.00
R0540:Fga UTSW 3 82,935,869 (GRCm39) missense probably damaging 1.00
R0607:Fga UTSW 3 82,935,869 (GRCm39) missense probably damaging 1.00
R1471:Fga UTSW 3 82,935,925 (GRCm39) missense probably benign 0.16
R1517:Fga UTSW 3 82,939,145 (GRCm39) missense probably benign 0.00
R1817:Fga UTSW 3 82,939,082 (GRCm39) missense probably benign 0.00
R1874:Fga UTSW 3 82,940,028 (GRCm39) missense probably damaging 1.00
R2014:Fga UTSW 3 82,940,064 (GRCm39) missense probably damaging 0.99
R2267:Fga UTSW 3 82,940,257 (GRCm39) missense probably damaging 1.00
R2332:Fga UTSW 3 82,938,704 (GRCm39) missense probably damaging 1.00
R2420:Fga UTSW 3 82,940,461 (GRCm39) missense possibly damaging 0.53
R2443:Fga UTSW 3 82,935,848 (GRCm39) missense probably benign 0.03
R3978:Fga UTSW 3 82,937,490 (GRCm39) critical splice acceptor site probably null
R4597:Fga UTSW 3 82,938,542 (GRCm39) nonsense probably null
R4644:Fga UTSW 3 82,937,573 (GRCm39) missense possibly damaging 0.81
R4760:Fga UTSW 3 82,938,821 (GRCm39) missense probably benign
R4867:Fga UTSW 3 82,935,951 (GRCm39) missense probably benign 0.00
R5449:Fga UTSW 3 82,938,169 (GRCm39) frame shift probably null
R5507:Fga UTSW 3 82,940,643 (GRCm39) missense probably damaging 1.00
R5712:Fga UTSW 3 82,940,440 (GRCm39) missense possibly damaging 0.70
R6853:Fga UTSW 3 82,938,219 (GRCm39) missense probably damaging 1.00
R7163:Fga UTSW 3 82,933,571 (GRCm39) missense probably benign 0.04
R7724:Fga UTSW 3 82,936,432 (GRCm39) missense probably damaging 0.99
R8153:Fga UTSW 3 82,938,164 (GRCm39) missense probably damaging 1.00
R8506:Fga UTSW 3 82,940,623 (GRCm39) missense probably damaging 1.00
R8511:Fga UTSW 3 82,939,064 (GRCm39) nonsense probably null
R8523:Fga UTSW 3 82,938,158 (GRCm39) missense probably damaging 1.00
R8801:Fga UTSW 3 82,938,188 (GRCm39) missense possibly damaging 0.89
R8906:Fga UTSW 3 82,939,111 (GRCm39) missense probably benign 0.12
R9390:Fga UTSW 3 82,940,610 (GRCm39) missense probably damaging 1.00
R9609:Fga UTSW 3 82,940,064 (GRCm39) missense probably damaging 1.00
X0062:Fga UTSW 3 82,937,578 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCTGATGGCACTGGAGACTG -3'
(R):5'- GGTCAGGATGCCTTTCAGAGAG -3'

Sequencing Primer
(F):5'- CTCAGACTCTGGGAACTTTAGGC -3'
(R):5'- CCTTTCAGAGAGTTCGTCGAGAC -3'
Posted On 2018-10-18