Incidental Mutation 'R6865:Fga'
ID535852
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R6865 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83031541 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 408 (C408S)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably damaging
Transcript: ENSMUST00000029630
AA Change: C408S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: C408S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166581
AA Change: C408S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: C408S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T A 13: 4,270,213 M293L possibly damaging Het
Ankrd11 T C 8: 122,894,944 D723G probably benign Het
Ankrd26 T C 6: 118,523,481 R1010G possibly damaging Het
Apob G A 12: 8,008,847 R2410H probably benign Het
Auh T C 13: 52,838,129 D275G probably damaging Het
Card10 G T 15: 78,802,622 D47E possibly damaging Het
Ccdc141 C T 2: 77,029,235 probably null Het
Cfap206 T C 4: 34,714,448 Y416C possibly damaging Het
Chuk A T 19: 44,086,915 Y500* probably null Het
Cop1 T A 1: 159,308,954 D536E probably damaging Het
Crh G C 3: 19,694,140 P113A possibly damaging Het
Ddx54 T G 5: 120,621,827 probably null Het
Efcab7 T C 4: 99,912,596 S127P probably damaging Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Flot2 T C 11: 78,049,492 S22P probably benign Het
Fndc1 T A 17: 7,772,840 T675S unknown Het
Foxc1 A G 13: 31,808,853 D549G unknown Het
Gldc T C 19: 30,133,762 N538S possibly damaging Het
Grk4 T G 5: 34,731,550 V346G probably damaging Het
Gucy2c T C 6: 136,770,129 R111G probably benign Het
Heatr6 C T 11: 83,769,140 H504Y probably damaging Het
Lrp5 A T 19: 3,620,013 probably null Het
Msrb1 T C 17: 24,736,711 S2P possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo3a A G 2: 22,574,301 I185V probably benign Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Nek6 A G 2: 38,569,666 I174V probably benign Het
Nmt2 T C 2: 3,314,729 V252A probably damaging Het
Nudt9 G T 5: 104,059,679 R179M probably damaging Het
Nwd1 T C 8: 72,657,062 V29A possibly damaging Het
Olah T C 2: 3,342,927 D216G possibly damaging Het
Olfr156 T C 4: 43,821,346 N5S probably benign Het
Olfr666 T C 7: 104,893,512 I39V probably benign Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pkd1 T C 17: 24,576,487 V2318A probably benign Het
Pknox1 T A 17: 31,588,560 M51K probably damaging Het
Ppp1r12a C T 10: 108,262,381 R321* probably null Het
Pxdn A G 12: 30,014,583 probably null Het
Rab44 A T 17: 29,139,227 I130F probably benign Het
Rnf130 T C 11: 50,071,264 I179T probably damaging Het
Slc22a28 A T 19: 8,064,491 C450* probably null Het
Slco1c1 A T 6: 141,540,052 Y136F probably damaging Het
Synj2 C T 17: 6,017,569 Q106* probably null Het
Uckl1 T C 2: 181,574,493 N138S probably damaging Het
Usp19 G T 9: 108,498,819 E203* probably null Het
Vdr A G 15: 97,857,505 I379T probably damaging Het
Zfp503 C A 14: 21,986,033 G272C probably damaging Het
Zfyve9 T C 4: 108,644,361 N1218S possibly damaging Het
Zzz3 T A 3: 152,428,053 D249E probably benign Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCTGATGGCACTGGAGACTG -3'
(R):5'- GGTCAGGATGCCTTTCAGAGAG -3'

Sequencing Primer
(F):5'- CTCAGACTCTGGGAACTTTAGGC -3'
(R):5'- CCTTTCAGAGAGTTCGTCGAGAC -3'
Posted On2018-10-18