Incidental Mutation 'R6865:Cfap206'
ID535854
Institutional Source Beutler Lab
Gene Symbol Cfap206
Ensembl Gene ENSMUSG00000028294
Gene Namecilia and flagella associated protein 206
Synonyms1700003M02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R6865 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location34688559-34730206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34714448 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 416 (Y416C)
Ref Sequence ENSEMBL: ENSMUSP00000103771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029971] [ENSMUST00000108136]
Predicted Effect probably benign
Transcript: ENSMUST00000029971
AA Change: Y416C

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029971
Gene: ENSMUSG00000028294
AA Change: Y416C

DomainStartEndE-ValueType
Pfam:DUF3508 214 491 6.1e-108 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108136
AA Change: Y416C

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103771
Gene: ENSMUSG00000028294
AA Change: Y416C

DomainStartEndE-ValueType
Pfam:DUF3508 213 493 3.8e-127 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T A 13: 4,270,213 M293L possibly damaging Het
Ankrd11 T C 8: 122,894,944 D723G probably benign Het
Ankrd26 T C 6: 118,523,481 R1010G possibly damaging Het
Apob G A 12: 8,008,847 R2410H probably benign Het
Auh T C 13: 52,838,129 D275G probably damaging Het
Card10 G T 15: 78,802,622 D47E possibly damaging Het
Ccdc141 C T 2: 77,029,235 probably null Het
Chuk A T 19: 44,086,915 Y500* probably null Het
Cop1 T A 1: 159,308,954 D536E probably damaging Het
Crh G C 3: 19,694,140 P113A possibly damaging Het
Ddx54 T G 5: 120,621,827 probably null Het
Efcab7 T C 4: 99,912,596 S127P probably damaging Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Fga T A 3: 83,031,541 C408S probably damaging Het
Flot2 T C 11: 78,049,492 S22P probably benign Het
Fndc1 T A 17: 7,772,840 T675S unknown Het
Foxc1 A G 13: 31,808,853 D549G unknown Het
Gldc T C 19: 30,133,762 N538S possibly damaging Het
Grk4 T G 5: 34,731,550 V346G probably damaging Het
Gucy2c T C 6: 136,770,129 R111G probably benign Het
Heatr6 C T 11: 83,769,140 H504Y probably damaging Het
Lrp5 A T 19: 3,620,013 probably null Het
Msrb1 T C 17: 24,736,711 S2P possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo3a A G 2: 22,574,301 I185V probably benign Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Nek6 A G 2: 38,569,666 I174V probably benign Het
Nmt2 T C 2: 3,314,729 V252A probably damaging Het
Nudt9 G T 5: 104,059,679 R179M probably damaging Het
Nwd1 T C 8: 72,657,062 V29A possibly damaging Het
Olah T C 2: 3,342,927 D216G possibly damaging Het
Olfr156 T C 4: 43,821,346 N5S probably benign Het
Olfr666 T C 7: 104,893,512 I39V probably benign Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pkd1 T C 17: 24,576,487 V2318A probably benign Het
Pknox1 T A 17: 31,588,560 M51K probably damaging Het
Ppp1r12a C T 10: 108,262,381 R321* probably null Het
Pxdn A G 12: 30,014,583 probably null Het
Rab44 A T 17: 29,139,227 I130F probably benign Het
Rnf130 T C 11: 50,071,264 I179T probably damaging Het
Slc22a28 A T 19: 8,064,491 C450* probably null Het
Slco1c1 A T 6: 141,540,052 Y136F probably damaging Het
Synj2 C T 17: 6,017,569 Q106* probably null Het
Uckl1 T C 2: 181,574,493 N138S probably damaging Het
Usp19 G T 9: 108,498,819 E203* probably null Het
Vdr A G 15: 97,857,505 I379T probably damaging Het
Zfp503 C A 14: 21,986,033 G272C probably damaging Het
Zfyve9 T C 4: 108,644,361 N1218S possibly damaging Het
Zzz3 T A 3: 152,428,053 D249E probably benign Het
Other mutations in Cfap206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00798:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00826:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00919:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01062:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01064:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01069:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01070:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01086:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01087:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01090:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01098:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01111:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01133:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01135:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01147:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01152:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01153:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01154:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01155:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01289:Cfap206 APN 4 34716469 missense probably null 0.98
IGL01845:Cfap206 APN 4 34719610 missense possibly damaging 0.57
IGL02115:Cfap206 APN 4 34722623 missense possibly damaging 0.54
IGL03241:Cfap206 APN 4 34711553 missense probably damaging 1.00
IGL03405:Cfap206 APN 4 34716445 missense possibly damaging 0.82
ANU05:Cfap206 UTSW 4 34721562 missense probably damaging 1.00
BB001:Cfap206 UTSW 4 34728833 missense not run
BB011:Cfap206 UTSW 4 34728833 missense not run
R0012:Cfap206 UTSW 4 34714519 missense possibly damaging 0.76
R0689:Cfap206 UTSW 4 34722668 missense probably benign 0.23
R0730:Cfap206 UTSW 4 34711391 missense probably benign
R1567:Cfap206 UTSW 4 34716490 missense probably benign 0.01
R1694:Cfap206 UTSW 4 34719058 missense probably damaging 1.00
R1706:Cfap206 UTSW 4 34688875 missense probably damaging 1.00
R1837:Cfap206 UTSW 4 34728813 missense probably damaging 1.00
R1909:Cfap206 UTSW 4 34722714 missense probably benign
R2098:Cfap206 UTSW 4 34719053 nonsense probably null
R2568:Cfap206 UTSW 4 34711566 nonsense probably null
R3125:Cfap206 UTSW 4 34716310 missense possibly damaging 0.48
R3784:Cfap206 UTSW 4 34716445 missense probably damaging 0.99
R5249:Cfap206 UTSW 4 34714502 missense probably benign
R5483:Cfap206 UTSW 4 34711404 missense probably benign 0.39
R5569:Cfap206 UTSW 4 34724892 missense probably damaging 1.00
R6247:Cfap206 UTSW 4 34692530 missense probably benign
R6555:Cfap206 UTSW 4 34719049 missense probably damaging 1.00
R6791:Cfap206 UTSW 4 34711414 missense possibly damaging 0.76
R7164:Cfap206 UTSW 4 34719656 missense probably benign
R7814:Cfap206 UTSW 4 34716347 missense probably benign 0.01
R8092:Cfap206 UTSW 4 34728897 missense possibly damaging 0.62
R8240:Cfap206 UTSW 4 34728902 start codon destroyed probably null 1.00
Z1176:Cfap206 UTSW 4 34719661 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGTCAGGTCCTCTTGGCATC -3'
(R):5'- TGCACCAGGGAAAACTTTGTC -3'

Sequencing Primer
(F):5'- GGCATCTCCTCCCTAGTTCAC -3'
(R):5'- GCACCAGGGAAAACTTTGTCAATTC -3'
Posted On2018-10-18