Incidental Mutation 'R6865:Heatr6'
ID535874
Institutional Source Beutler Lab
Gene Symbol Heatr6
Ensembl Gene ENSMUSG00000000976
Gene NameHEAT repeat containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R6865 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location83753696-83783754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83769140 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 504 (H504Y)
Ref Sequence ENSEMBL: ENSMUSP00000001002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001002]
Predicted Effect probably damaging
Transcript: ENSMUST00000001002
AA Change: H504Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001002
Gene: ENSMUSG00000000976
AA Change: H504Y

DomainStartEndE-ValueType
low complexity region 160 174 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
low complexity region 329 348 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Pfam:DUF4042 421 602 9.6e-73 PFAM
low complexity region 603 627 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 1078 1091 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T A 13: 4,270,213 M293L possibly damaging Het
Ankrd11 T C 8: 122,894,944 D723G probably benign Het
Ankrd26 T C 6: 118,523,481 R1010G possibly damaging Het
Apob G A 12: 8,008,847 R2410H probably benign Het
Auh T C 13: 52,838,129 D275G probably damaging Het
Card10 G T 15: 78,802,622 D47E possibly damaging Het
Ccdc141 C T 2: 77,029,235 probably null Het
Cfap206 T C 4: 34,714,448 Y416C possibly damaging Het
Chuk A T 19: 44,086,915 Y500* probably null Het
Cop1 T A 1: 159,308,954 D536E probably damaging Het
Crh G C 3: 19,694,140 P113A possibly damaging Het
Ddx54 T G 5: 120,621,827 probably null Het
Efcab7 T C 4: 99,912,596 S127P probably damaging Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Fga T A 3: 83,031,541 C408S probably damaging Het
Flot2 T C 11: 78,049,492 S22P probably benign Het
Fndc1 T A 17: 7,772,840 T675S unknown Het
Foxc1 A G 13: 31,808,853 D549G unknown Het
Gldc T C 19: 30,133,762 N538S possibly damaging Het
Grk4 T G 5: 34,731,550 V346G probably damaging Het
Gucy2c T C 6: 136,770,129 R111G probably benign Het
Lrp5 A T 19: 3,620,013 probably null Het
Msrb1 T C 17: 24,736,711 S2P possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo3a A G 2: 22,574,301 I185V probably benign Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Nek6 A G 2: 38,569,666 I174V probably benign Het
Nmt2 T C 2: 3,314,729 V252A probably damaging Het
Nudt9 G T 5: 104,059,679 R179M probably damaging Het
Nwd1 T C 8: 72,657,062 V29A possibly damaging Het
Olah T C 2: 3,342,927 D216G possibly damaging Het
Olfr156 T C 4: 43,821,346 N5S probably benign Het
Olfr666 T C 7: 104,893,512 I39V probably benign Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pkd1 T C 17: 24,576,487 V2318A probably benign Het
Pknox1 T A 17: 31,588,560 M51K probably damaging Het
Ppp1r12a C T 10: 108,262,381 R321* probably null Het
Pxdn A G 12: 30,014,583 probably null Het
Rab44 A T 17: 29,139,227 I130F probably benign Het
Rnf130 T C 11: 50,071,264 I179T probably damaging Het
Slc22a28 A T 19: 8,064,491 C450* probably null Het
Slco1c1 A T 6: 141,540,052 Y136F probably damaging Het
Synj2 C T 17: 6,017,569 Q106* probably null Het
Uckl1 T C 2: 181,574,493 N138S probably damaging Het
Usp19 G T 9: 108,498,819 E203* probably null Het
Vdr A G 15: 97,857,505 I379T probably damaging Het
Zfp503 C A 14: 21,986,033 G272C probably damaging Het
Zfyve9 T C 4: 108,644,361 N1218S possibly damaging Het
Zzz3 T A 3: 152,428,053 D249E probably benign Het
Other mutations in Heatr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Heatr6 APN 11 83759309 missense probably damaging 1.00
IGL01681:Heatr6 APN 11 83765000 missense probably benign 0.08
IGL01905:Heatr6 APN 11 83781712 missense probably benign 0.06
IGL02037:Heatr6 APN 11 83764882 splice site probably benign
IGL02313:Heatr6 APN 11 83778892 missense probably damaging 1.00
IGL02652:Heatr6 APN 11 83769732 missense probably damaging 1.00
IGL03004:Heatr6 APN 11 83757379 missense probably benign 0.01
IGL03229:Heatr6 APN 11 83781445 missense probably benign 0.01
IGL03386:Heatr6 APN 11 83759377 missense probably damaging 1.00
IGL02802:Heatr6 UTSW 11 83760936 missense probably damaging 1.00
R0537:Heatr6 UTSW 11 83779464 nonsense probably null
R1658:Heatr6 UTSW 11 83758367 missense probably damaging 1.00
R1864:Heatr6 UTSW 11 83769230 missense probably damaging 0.97
R1893:Heatr6 UTSW 11 83757314 missense probably benign 0.33
R1944:Heatr6 UTSW 11 83769220 missense probably damaging 1.00
R2115:Heatr6 UTSW 11 83757455 unclassified probably benign
R3019:Heatr6 UTSW 11 83778832 splice site probably null
R4050:Heatr6 UTSW 11 83755773 missense probably damaging 0.99
R4532:Heatr6 UTSW 11 83769672 missense probably damaging 1.00
R4576:Heatr6 UTSW 11 83765000 missense probably benign 0.08
R4724:Heatr6 UTSW 11 83779548 nonsense probably null
R4825:Heatr6 UTSW 11 83758322 missense probably damaging 1.00
R5489:Heatr6 UTSW 11 83774432 missense probably damaging 1.00
R5970:Heatr6 UTSW 11 83753718 unclassified probably benign
R6136:Heatr6 UTSW 11 83772503 missense possibly damaging 0.94
R6145:Heatr6 UTSW 11 83766136 missense probably damaging 1.00
R6649:Heatr6 UTSW 11 83759365 missense probably benign 0.01
R6653:Heatr6 UTSW 11 83759365 missense probably benign 0.01
R6791:Heatr6 UTSW 11 83758341 missense probably benign
R7154:Heatr6 UTSW 11 83777241 missense probably benign 0.05
R7385:Heatr6 UTSW 11 83759335 missense probably damaging 0.96
R7473:Heatr6 UTSW 11 83781391 missense probably damaging 1.00
X0014:Heatr6 UTSW 11 83781250 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTAGCTACCCTCAGTACCC -3'
(R):5'- TTGAGGTGTGACACAATACACTAC -3'

Sequencing Primer
(F):5'- GTTCTTCTAATAAGCTGGCGC -3'
(R):5'- GGTGTGACACAATACACTACATAAAC -3'
Posted On2018-10-18