Incidental Mutation 'R6865:Gldc'
ID 535891
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 045027-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6865 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30111162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 538 (N538S)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect possibly damaging
Transcript: ENSMUST00000025778
AA Change: N538S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: N538S

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T A 13: 4,320,212 (GRCm39) M293L possibly damaging Het
Ankrd11 T C 8: 123,621,683 (GRCm39) D723G probably benign Het
Ankrd26 T C 6: 118,500,442 (GRCm39) R1010G possibly damaging Het
Apob G A 12: 8,058,847 (GRCm39) R2410H probably benign Het
Auh T C 13: 52,992,165 (GRCm39) D275G probably damaging Het
Card10 G T 15: 78,686,822 (GRCm39) D47E possibly damaging Het
Ccdc141 C T 2: 76,859,579 (GRCm39) probably null Het
Cfap206 T C 4: 34,714,448 (GRCm39) Y416C possibly damaging Het
Chuk A T 19: 44,075,354 (GRCm39) Y500* probably null Het
Cop1 T A 1: 159,136,524 (GRCm39) D536E probably damaging Het
Crh G C 3: 19,748,304 (GRCm39) P113A possibly damaging Het
Ddx54 T G 5: 120,759,892 (GRCm39) probably null Het
Efcab7 T C 4: 99,769,793 (GRCm39) S127P probably damaging Het
Efhc1 A G 1: 21,030,442 (GRCm39) Y125C probably damaging Het
Fga T A 3: 82,938,848 (GRCm39) C408S probably damaging Het
Flot2 T C 11: 77,940,318 (GRCm39) S22P probably benign Het
Fndc1 T A 17: 7,991,672 (GRCm39) T675S unknown Het
Foxc1 A G 13: 31,992,836 (GRCm39) D549G unknown Het
Grk4 T G 5: 34,888,894 (GRCm39) V346G probably damaging Het
Gucy2c T C 6: 136,747,127 (GRCm39) R111G probably benign Het
Heatr6 C T 11: 83,659,966 (GRCm39) H504Y probably damaging Het
Lrp5 A T 19: 3,670,013 (GRCm39) probably null Het
Msrb1 T C 17: 24,955,685 (GRCm39) S2P possibly damaging Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Myo3a A G 2: 22,464,313 (GRCm39) I185V probably benign Het
Myo5c T C 9: 75,176,878 (GRCm39) S608P probably benign Het
Nek6 A G 2: 38,459,678 (GRCm39) I174V probably benign Het
Nmt2 T C 2: 3,315,766 (GRCm39) V252A probably damaging Het
Nudt9 G T 5: 104,207,545 (GRCm39) R179M probably damaging Het
Nwd1 T C 8: 73,383,690 (GRCm39) V29A possibly damaging Het
Olah T C 2: 3,343,964 (GRCm39) D216G possibly damaging Het
Or13c7b T C 4: 43,821,346 (GRCm39) N5S probably benign Het
Or52n2 T C 7: 104,542,719 (GRCm39) I39V probably benign Het
Parp12 T C 6: 39,088,670 (GRCm39) I189V probably benign Het
Pkd1 T C 17: 24,795,461 (GRCm39) V2318A probably benign Het
Pknox1 T A 17: 31,807,534 (GRCm39) M51K probably damaging Het
Ppp1r12a C T 10: 108,098,242 (GRCm39) R321* probably null Het
Pxdn A G 12: 30,064,582 (GRCm39) probably null Het
Rab44 A T 17: 29,358,201 (GRCm39) I130F probably benign Het
Rnf130 T C 11: 49,962,091 (GRCm39) I179T probably damaging Het
Slc22a28 A T 19: 8,041,856 (GRCm39) C450* probably null Het
Slco1c1 A T 6: 141,485,778 (GRCm39) Y136F probably damaging Het
Synj2 C T 17: 6,067,844 (GRCm39) Q106* probably null Het
Uckl1 T C 2: 181,216,286 (GRCm39) N138S probably damaging Het
Usp19 G T 9: 108,376,018 (GRCm39) E203* probably null Het
Vdr A G 15: 97,755,386 (GRCm39) I379T probably damaging Het
Zfp503 C A 14: 22,036,101 (GRCm39) G272C probably damaging Het
Zfyve9 T C 4: 108,501,558 (GRCm39) N1218S possibly damaging Het
Zzz3 T A 3: 152,133,690 (GRCm39) D249E probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATGCCCCATCTATGAACC -3'
(R):5'- GAAGTTCATCTCAGGAACCCCG -3'

Sequencing Primer
(F):5'- ATGCCCCATCTATGAACCTTCCC -3'
(R):5'- ATCTCAGGAACCCCGTGTCC -3'
Posted On 2018-10-18