Incidental Mutation 'R6865:Chuk'
ID535892
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6865 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 44086915 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 500 (Y500*)
Ref Sequence ENSEMBL: ENSMUSP00000113809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably null
Transcript: ENSMUST00000026217
AA Change: Y500*
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: Y500*

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119591
AA Change: Y500*
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: Y500*

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T A 13: 4,270,213 M293L possibly damaging Het
Ankrd11 T C 8: 122,894,944 D723G probably benign Het
Ankrd26 T C 6: 118,523,481 R1010G possibly damaging Het
Apob G A 12: 8,008,847 R2410H probably benign Het
Auh T C 13: 52,838,129 D275G probably damaging Het
Card10 G T 15: 78,802,622 D47E possibly damaging Het
Ccdc141 C T 2: 77,029,235 probably null Het
Cfap206 T C 4: 34,714,448 Y416C possibly damaging Het
Cop1 T A 1: 159,308,954 D536E probably damaging Het
Crh G C 3: 19,694,140 P113A possibly damaging Het
Ddx54 T G 5: 120,621,827 probably null Het
Efcab7 T C 4: 99,912,596 S127P probably damaging Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Fga T A 3: 83,031,541 C408S probably damaging Het
Flot2 T C 11: 78,049,492 S22P probably benign Het
Fndc1 T A 17: 7,772,840 T675S unknown Het
Foxc1 A G 13: 31,808,853 D549G unknown Het
Gldc T C 19: 30,133,762 N538S possibly damaging Het
Grk4 T G 5: 34,731,550 V346G probably damaging Het
Gucy2c T C 6: 136,770,129 R111G probably benign Het
Heatr6 C T 11: 83,769,140 H504Y probably damaging Het
Lrp5 A T 19: 3,620,013 probably null Het
Msrb1 T C 17: 24,736,711 S2P possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo3a A G 2: 22,574,301 I185V probably benign Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Nek6 A G 2: 38,569,666 I174V probably benign Het
Nmt2 T C 2: 3,314,729 V252A probably damaging Het
Nudt9 G T 5: 104,059,679 R179M probably damaging Het
Nwd1 T C 8: 72,657,062 V29A possibly damaging Het
Olah T C 2: 3,342,927 D216G possibly damaging Het
Olfr156 T C 4: 43,821,346 N5S probably benign Het
Olfr666 T C 7: 104,893,512 I39V probably benign Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pkd1 T C 17: 24,576,487 V2318A probably benign Het
Pknox1 T A 17: 31,588,560 M51K probably damaging Het
Ppp1r12a C T 10: 108,262,381 R321* probably null Het
Pxdn A G 12: 30,014,583 probably null Het
Rab44 A T 17: 29,139,227 I130F probably benign Het
Rnf130 T C 11: 50,071,264 I179T probably damaging Het
Slc22a28 A T 19: 8,064,491 C450* probably null Het
Slco1c1 A T 6: 141,540,052 Y136F probably damaging Het
Synj2 C T 17: 6,017,569 Q106* probably null Het
Uckl1 T C 2: 181,574,493 N138S probably damaging Het
Usp19 G T 9: 108,498,819 E203* probably null Het
Vdr A G 15: 97,857,505 I379T probably damaging Het
Zfp503 C A 14: 21,986,033 G272C probably damaging Het
Zfyve9 T C 4: 108,644,361 N1218S possibly damaging Het
Zzz3 T A 3: 152,428,053 D249E probably benign Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAAGGAATGAAATGAGCTAACCCTC -3'
(R):5'- AGGCCAGCTAGTTCTCTGAATTG -3'

Sequencing Primer
(F):5'- GAATGAAATGAGCTAACCCTCAAAAC -3'
(R):5'- AAATTTAGGTTCTGGAGTTTGGATAC -3'
Posted On2018-10-18