Mutagenetix > Incidental Mutations

Incidental Mutation 'R6866:Dnah7c'

535893

Institutional Source

Beutler Lab

Gene Symbol

Dnah7c

Ensembl Gene

ENSMUSG00000101337

Gene Name

dynein, axonemal, heavy chain 7C

Synonyms

Dnahc7c

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.345) question?

Stock #

R6866 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46425592-46807476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 46657243 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 2095 (P2095Q)

Ref Sequence

ENSEMBL: ENSMUSP00000140430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000189749]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000189749
AA Change: P2095Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: P2095Q

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	37	48	N/A	INTRINSIC
coiled coil region	714	746	N/A	INTRINSIC
Pfam:DHC_N2	754	1167	2.2e-138	PFAM
AAA	1320	1459	4e-3	SMART
Blast:AAA	1601	1829	4e-87	BLAST
AAA	1968	2116	8.7e-4	SMART
Pfam:AAA_8	2303	2574	6.2e-73	PFAM
Pfam:MT	2586	2935	5.4e-52	PFAM
Pfam:AAA_9	2953	3183	7.4e-63	PFAM
Pfam:Dynein_heavy	3312	4021	1.3e-250	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	ACTGCACCACCT	ACT	10: 43,532,725		probably benign	Het
Alms1	A	G	6: 85,621,098	T1438A	possibly damaging	Het
Als2	T	A	1: 59,211,133	Q484L	probably damaging	Het
Apeh	G	A	9: 108,092,679	H186Y	probably damaging	Het
BC051142	T	A	17: 34,459,961	C216S	possibly damaging	Het
Bcl2l13	T	A	6: 120,862,889	N49K	probably benign	Het
Bptf	T	C	11: 107,073,580	D1596G	probably damaging	Het
Brsk1	T	C	7: 4,706,407	M325T	probably damaging	Het
C87499	T	A	4: 88,627,740	D455V	probably damaging	Het
Caly	T	C	7: 140,070,619	M137V	probably benign	Het
Cdca2	T	C	14: 67,693,666	E526G	possibly damaging	Het
Cnga4	A	G	7: 105,407,745	S352G	possibly damaging	Het
Cntnap5c	A	C	17: 58,092,294	T381P	probably benign	Het
Cr2	T	A	1: 195,151,691	Y633F	probably damaging	Het
Cryba1	T	C	11: 77,719,529	N120S	probably benign	Het
Cyfip2	G	A	11: 46,242,459	R805*	probably null	Het
Eif3k	T	C	7: 28,977,226	E110G	possibly damaging	Het
Extl2	A	G	3: 116,027,352	M283V	probably damaging	Het
Extl2	T	A	3: 116,027,353	M283K	probably damaging	Het
Focad	T	C	4: 88,403,386	I1658T	probably benign	Het
Fstl5	A	T	3: 76,322,225	H111L	probably damaging	Het
Garnl3	A	G	2: 33,002,773		probably null	Het
Gm3633	T	A	14: 42,640,622		probably benign	Het
Il4i1	T	A	7: 44,836,539		probably null	Het
Kcnj6	A	T	16: 94,762,677	C321S	probably damaging	Het
Kif20a	A	T	18: 34,628,493	Y313F	probably benign	Het
Kmt2d	T	G	15: 98,857,393		probably benign	Het
Kynu	T	A	2: 43,563,110	Y48*	probably null	Het
Ly9	T	C	1: 171,605,279	I55M	probably damaging	Het
Mgme1	T	C	2: 144,276,519	V237A	probably damaging	Het
Mmp16	T	A	4: 17,853,800	L27H	probably benign	Het
Myh1	A	C	11: 67,224,393	D1918A	probably damaging	Het
Myo5a	G	A	9: 75,140,688	C266Y	probably damaging	Het
Nckap5l	A	G	15: 99,426,468	I718T	probably benign	Het
Nptx1	A	G	11: 119,546,650		probably null	Het
Olfr180	A	G	16: 58,915,988	Y218H	probably damaging	Het
Olfr502	A	G	7: 108,523,170	F260S	probably damaging	Het
Olfr682-ps1	T	A	7: 105,126,618	M228L	probably benign	Het
Phc3	T	A	3: 30,914,531	K783*	probably null	Het
Pkdrej	A	T	15: 85,820,881	C285S	probably damaging	Het
Pot1b	T	A	17: 55,653,474	T619S	possibly damaging	Het
Psg21	A	T	7: 18,652,284	V259E	probably damaging	Het
Pvr	A	C	7: 19,918,630	I120S	probably benign	Het
Rbm17	T	G	2: 11,598,090	I68L	probably benign	Het
Rnf138	C	T	18: 21,002,142	P28L	probably damaging	Het
Rnf207	C	T	4: 152,312,532	C385Y	possibly damaging	Het
Serping1	A	C	2: 84,770,233	V255G	probably benign	Het
Slc25a3	A	T	10: 91,119,705	V91E	probably damaging	Het
Slc26a8	T	C	17: 28,638,481	D896G	probably benign	Het
Slc27a5	T	A	7: 12,997,516	T183S	probably benign	Het
Slc33a1	A	T	3: 63,943,323	F527I	probably benign	Het
Strn4	A	T	7: 16,828,785	D283V	probably damaging	Het
Sult1e1	G	A	5: 87,586,766	T107I	probably damaging	Het
Tango6	G	A	8: 106,742,472		probably null	Het
Tecrl	G	T	5: 83,313,314	P99T	probably damaging	Het
Ticrr	T	C	7: 79,693,957	L1190P	possibly damaging	Het
Timm50	C	T	7: 28,305,945	R349H	probably damaging	Het
Tjp2	A	G	19: 24,101,991	I840T	probably damaging	Het
Tmem173	T	C	18: 35,739,429	H50R	probably damaging	Het
Tmem45a2	T	A	16: 57,047,023	N105I	probably damaging	Het
Zfp148	T	A	16: 33,468,126	C162S	probably damaging	Het
Zfp534	T	C	4: 147,674,481	K577R	probably benign	Het

Other mutations in Dnah7c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Dnah7c	APN	1	46807289	missense	possibly damaging	0.72
IGL02958:Dnah7c	APN	1	46657111	missense	probably damaging	1.00
IGL03035:Dnah7c	APN	1	46524117	missense	probably benign	0.37
IGL03161:Dnah7c	APN	1	46467296	missense	probably benign	0.20
IGL03178:Dnah7c	APN	1	46467365	missense	probably benign
IGL03052:Dnah7c	UTSW	1	46632149	missense	probably damaging	1.00
R0751:Dnah7c	UTSW	1	46465905	missense	probably benign
R1029:Dnah7c	UTSW	1	46612721	missense	probably damaging	1.00
R3104:Dnah7c	UTSW	1	46798279	missense	probably damaging	0.97
R3977:Dnah7c	UTSW	1	46628911	missense	possibly damaging	0.75
R4003:Dnah7c	UTSW	1	46681817	missense	probably damaging	1.00
R4133:Dnah7c	UTSW	1	46665990	missense	probably benign	0.01
R4303:Dnah7c	UTSW	1	46748578	missense	probably damaging	1.00
R4329:Dnah7c	UTSW	1	46649281	missense	probably benign	0.33
R4434:Dnah7c	UTSW	1	46666282	missense	probably damaging	1.00
R4457:Dnah7c	UTSW	1	46740621	missense	probably damaging	1.00
R4470:Dnah7c	UTSW	1	46748635	missense	possibly damaging	0.56
R4507:Dnah7c	UTSW	1	46766611	missense	probably damaging	1.00
R4527:Dnah7c	UTSW	1	46532931	missense	probably benign	0.34
R4571:Dnah7c	UTSW	1	46533216	missense	probably damaging	0.99
R4589:Dnah7c	UTSW	1	46514583	nonsense	probably null
R4731:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4732:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4733:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4747:Dnah7c	UTSW	1	46533168	missense	probably damaging	1.00
R4845:Dnah7c	UTSW	1	46793532	missense	probably damaging	1.00
R4873:Dnah7c	UTSW	1	46688925	missense	probably benign
R4875:Dnah7c	UTSW	1	46688925	missense	probably benign
R4916:Dnah7c	UTSW	1	46595008	missense	probably damaging	1.00
R5241:Dnah7c	UTSW	1	46530500	missense	probably benign
R5279:Dnah7c	UTSW	1	46519269	missense	probably benign	0.14
R5327:Dnah7c	UTSW	1	46665568	missense	probably benign	0.05
R5546:Dnah7c	UTSW	1	46666317	missense	probably damaging	1.00
R5605:Dnah7c	UTSW	1	46798235	missense	possibly damaging	0.84
R5637:Dnah7c	UTSW	1	46760361	splice site	probably null
R5639:Dnah7c	UTSW	1	46739668	missense	probably benign
R5663:Dnah7c	UTSW	1	46535148	missense	probably damaging	1.00
R5718:Dnah7c	UTSW	1	46748666	missense	possibly damaging	0.47
R5759:Dnah7c	UTSW	1	46615367	missense	probably damaging	1.00
R5771:Dnah7c	UTSW	1	46639665	missense	probably benign	0.00
R5784:Dnah7c	UTSW	1	46524068	missense	possibly damaging	0.80
R5800:Dnah7c	UTSW	1	46647015	missense	probably benign	0.01
R5933:Dnah7c	UTSW	1	46519215	missense	probably damaging	1.00
R5948:Dnah7c	UTSW	1	46672497	missense	probably benign	0.21
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6487:Dnah7c	UTSW	1	46769124	missense	probably damaging	1.00
R6536:Dnah7c	UTSW	1	46658290	missense	probably benign	0.00
R6614:Dnah7c	UTSW	1	46649340	missense	probably benign
R6614:Dnah7c	UTSW	1	46649351	missense	probably benign
R6615:Dnah7c	UTSW	1	46515439	missense	probably benign	0.01
R6615:Dnah7c	UTSW	1	46649340	missense	probably benign
R6615:Dnah7c	UTSW	1	46649351	missense	probably benign
R6649:Dnah7c	UTSW	1	46649340	missense	probably benign
R6649:Dnah7c	UTSW	1	46649351	missense	probably benign
R6650:Dnah7c	UTSW	1	46649340	missense	probably benign
R6650:Dnah7c	UTSW	1	46649351	missense	probably benign
R6651:Dnah7c	UTSW	1	46649340	missense	probably benign
R6651:Dnah7c	UTSW	1	46649351	missense	probably benign
R6653:Dnah7c	UTSW	1	46649340	missense	probably benign
R6653:Dnah7c	UTSW	1	46649351	missense	probably benign
R6714:Dnah7c	UTSW	1	46740806	missense	probably damaging	0.99
R6729:Dnah7c	UTSW	1	46672521	missense	possibly damaging	0.46
R6760:Dnah7c	UTSW	1	46649340	missense	probably benign
R6760:Dnah7c	UTSW	1	46649351	missense	probably benign
R6763:Dnah7c	UTSW	1	46628890	missense	possibly damaging	0.60
R6880:Dnah7c	UTSW	1	46527671	missense	probably damaging	0.97
R6988:Dnah7c	UTSW	1	46666213	missense	possibly damaging	0.68
R6995:Dnah7c	UTSW	1	46455813	missense	probably benign	0.07
R7007:Dnah7c	UTSW	1	46532750	missense	probably benign	0.04
R7086:Dnah7c	UTSW	1	46750125	missense	probably benign	0.00
R7128:Dnah7c	UTSW	1	46527485	missense	probably benign
R7131:Dnah7c	UTSW	1	46681772	missense	probably benign	0.00
R7135:Dnah7c	UTSW	1	46533208	missense	probably damaging	1.00
R7171:Dnah7c	UTSW	1	46680738	missense	probably damaging	0.99
R7176:Dnah7c	UTSW	1	46430809	missense	probably benign	0.00
R7221:Dnah7c	UTSW	1	46455777	missense	possibly damaging	0.87
R7310:Dnah7c	UTSW	1	46596967	missense	possibly damaging	0.94
R7319:Dnah7c	UTSW	1	46780775	missense	probably benign	0.31
R7319:Dnah7c	UTSW	1	46784448	missense	possibly damaging	0.95
R7404:Dnah7c	UTSW	1	46666063	missense	possibly damaging	0.52
R7452:Dnah7c	UTSW	1	46647036	missense	possibly damaging	0.91
R7515:Dnah7c	UTSW	1	46457290	missense	probably benign
R7534:Dnah7c	UTSW	1	46770067	missense	probably damaging	0.98
R7542:Dnah7c	UTSW	1	46784498	missense	probably benign	0.00
R7605:Dnah7c	UTSW	1	46632310	missense	probably damaging	1.00
R7643:Dnah7c	UTSW	1	46602813	missense	probably benign
R7770:Dnah7c	UTSW	1	46626300	splice site	probably null
R7884:Dnah7c	UTSW	1	46791769	missense	probably benign	0.23
R7899:Dnah7c	UTSW	1	46514701	missense	probably benign	0.00
R8025:Dnah7c	UTSW	1	46457296	missense	probably benign	0.01
R8057:Dnah7c	UTSW	1	46688952	missense	possibly damaging	0.52
R8191:Dnah7c	UTSW	1	46607458	missense	possibly damaging	0.56
R8255:Dnah7c	UTSW	1	46659429	missense	probably damaging	1.00
R8428:Dnah7c	UTSW	1	46672376	missense	probably damaging	1.00
R8441:Dnah7c	UTSW	1	46533238	missense	probably damaging	1.00
R8485:Dnah7c	UTSW	1	46680792	missense	probably benign	0.05
R8559:Dnah7c	UTSW	1	46725139	missense	probably damaging	1.00
R8752:Dnah7c	UTSW	1	46672541	missense	probably benign	0.00
R8869:Dnah7c	UTSW	1	46632344	missense	probably damaging	0.97
R9058:Dnah7c	UTSW	1	46766656	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46665490	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46777736	missense	probably benign	0.00
R9246:Dnah7c	UTSW	1	46532774	missense	possibly damaging	0.51
R9319:Dnah7c	UTSW	1	46482008	missense	possibly damaging	0.94
R9388:Dnah7c	UTSW	1	46740726	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46467302	missense	probably benign	0.00
Z1176:Dnah7c	UTSW	1	46615281	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46639665	missense	probably benign
Z1176:Dnah7c	UTSW	1	46646992	critical splice acceptor site	probably null
Z1176:Dnah7c	UTSW	1	46760316	missense	possibly damaging	0.95
Z1177:Dnah7c	UTSW	1	46654103	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AAGAGGCTTGAGTGCTAATATTCTC -3'
(R):5'- GAAGAGTCCATTCCTCTGGGTTTTC -3'

Sequencing Primer
(F):5'- GGCTTGAGTGCTAATATTCTCAAATC -3'
(R):5'- GCAAGACAGGCTATGCAA -3'

Posted On

2018-10-18