Incidental Mutation 'R6866:Ly9'
ID535895
Institutional Source Beutler Lab
Gene Symbol Ly9
Ensembl Gene ENSMUSG00000004707
Gene Namelymphocyte antigen 9
SynonymsT100, CD229, Lgp100, SLAMF3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171588624-171607410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171605279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 55 (I55M)
Ref Sequence ENSEMBL: ENSMUSP00000106908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004827] [ENSMUST00000068878] [ENSMUST00000111277] [ENSMUST00000143463] [ENSMUST00000194797]
Predicted Effect probably benign
Transcript: ENSMUST00000004827
SMART Domains Protein: ENSMUSP00000004827
Gene: ENSMUSG00000004707

DomainStartEndE-ValueType
Pfam:Ig_3 46 116 7.9e-9 PFAM
Pfam:Ig_2 46 129 5.4e-10 PFAM
IG 143 246 1.49e-2 SMART
Pfam:Ig_3 251 320 4.1e-13 PFAM
Pfam:Ig_2 251 330 7.5e-6 PFAM
transmembrane domain 345 364 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068878
AA Change: I55M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069319
Gene: ENSMUSG00000004707
AA Change: I55M

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 5.6e-8 PFAM
Pfam:Ig_2 156 239 4e-8 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5.4e-10 PFAM
low complexity region 433 441 N/A INTRINSIC
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111277
AA Change: I55M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106908
Gene: ENSMUSG00000004707
AA Change: I55M

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 9.9e-9 PFAM
Pfam:Ig_2 156 239 6.8e-10 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5e-13 PFAM
Pfam:Ig_2 361 440 9.4e-6 PFAM
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143463
SMART Domains Protein: ENSMUSP00000137924
Gene: ENSMUSG00000004707

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194797
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 [PubMed 16365421]).[supplied by OMIM, Mar 2008]
PHENOTYPE: This locus controls an antigen on thymocytes, lymphocytes and bone marrow cells. The a allele determines Ly9.1 antigen in A/J, 129/Re, BALB/c and C3H/He; the b allele determines antigen Ly9.2 in the C57 family of strains, HTI/Go, MA/My, F/St and C58/Lw. Null mutants are viable, healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Ly9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ly9 APN 1 171593451 missense probably damaging 1.00
IGL00640:Ly9 APN 1 171601879 missense possibly damaging 0.65
IGL01899:Ly9 APN 1 171607247 missense probably damaging 0.99
IGL02714:Ly9 APN 1 171605118 missense possibly damaging 0.60
IGL03086:Ly9 APN 1 171605170 missense probably benign 0.01
R0647:Ly9 UTSW 1 171599808 missense probably damaging 1.00
R1292:Ly9 UTSW 1 171589103 unclassified probably null
R1422:Ly9 UTSW 1 171601212 missense probably damaging 1.00
R1598:Ly9 UTSW 1 171596507 missense probably benign 0.03
R1985:Ly9 UTSW 1 171599773 missense probably damaging 1.00
R2219:Ly9 UTSW 1 171597681 splice site probably null
R2427:Ly9 UTSW 1 171607232 missense probably damaging 0.99
R3764:Ly9 UTSW 1 171594144 missense possibly damaging 0.92
R3815:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3816:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3817:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3819:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R4590:Ly9 UTSW 1 171593875 nonsense probably null
R4653:Ly9 UTSW 1 171594029 missense probably benign 0.41
R4755:Ly9 UTSW 1 171607238 missense probably damaging 0.99
R4871:Ly9 UTSW 1 171607330 intron probably benign
R5167:Ly9 UTSW 1 171605205 missense probably damaging 1.00
R5203:Ly9 UTSW 1 171599779 missense probably damaging 1.00
R5270:Ly9 UTSW 1 171601162 missense probably damaging 0.99
R5692:Ly9 UTSW 1 171605187 frame shift probably null
R5996:Ly9 UTSW 1 171601828 missense probably damaging 1.00
R6389:Ly9 UTSW 1 171596537 missense probably damaging 1.00
R6391:Ly9 UTSW 1 171601008 missense possibly damaging 0.76
R6457:Ly9 UTSW 1 171589095 missense probably damaging 1.00
R6730:Ly9 UTSW 1 171605169 missense probably benign 0.14
R6732:Ly9 UTSW 1 171594085 missense possibly damaging 0.74
R6862:Ly9 UTSW 1 171601155 missense probably benign 0.21
R7455:Ly9 UTSW 1 171593939 nonsense probably null
X0062:Ly9 UTSW 1 171605221 missense possibly damaging 0.82
Z1176:Ly9 UTSW 1 171594060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCATGGTAGGATCCTGAATCAC -3'
(R):5'- AAGGAGAATGTCTGGTCTCATTC -3'

Sequencing Primer
(F):5'- TACAAGGAGTAGCCATCTTCGCTG -3'
(R):5'- GAGAATGTCTGGTCTCATTCATTTC -3'
Posted On2018-10-18