Incidental Mutation 'R6866:Cr2'
ID535896
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Namecomplement receptor 2
SynonymsC3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location195136811-195176716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 195151691 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 633 (Y633F)
Ref Sequence ENSEMBL: ENSMUSP00000141706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
Predicted Effect probably damaging
Transcript: ENSMUST00000082321
AA Change: Y930F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: Y930F

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193356
AA Change: Y633F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: Y633F

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: Y930F

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: Y930F

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210219
AA Change: Y1306F

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGATGTGCCCCATACTCAAC -3'
(R):5'- CTGCAATTCAGTGAAGCTTTGC -3'

Sequencing Primer
(F):5'- GTGATGTGCCCCATACTCAACTATAC -3'
(R):5'- CTTTCCTAGTAAGGACATTTTCT -3'
Posted On2018-10-18