Mutagenetix > Incidental Mutation

Incidental Mutation 'R6866:Cr2'

535896

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

044965-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R6866 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 195151691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 633 (Y633F)

Ref Sequence

ENSEMBL: ENSMUSP00000141706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: Y930F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: Y930F

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: Y633F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: Y633F

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193436

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: Y930F

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: Y930F

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000210219
AA Change: Y1306F

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	ACTGCACCACCT	ACT	10: 43,532,725		probably benign	Het
Alms1	A	G	6: 85,621,098	T1438A	possibly damaging	Het
Als2	T	A	1: 59,211,133	Q484L	probably damaging	Het
Apeh	G	A	9: 108,092,679	H186Y	probably damaging	Het
BC051142	T	A	17: 34,459,961	C216S	possibly damaging	Het
Bcl2l13	T	A	6: 120,862,889	N49K	probably benign	Het
Bptf	T	C	11: 107,073,580	D1596G	probably damaging	Het
Brsk1	T	C	7: 4,706,407	M325T	probably damaging	Het
C87499	T	A	4: 88,627,740	D455V	probably damaging	Het
Caly	T	C	7: 140,070,619	M137V	probably benign	Het
Cdca2	T	C	14: 67,693,666	E526G	possibly damaging	Het
Cnga4	A	G	7: 105,407,745	S352G	possibly damaging	Het
Cntnap5c	A	C	17: 58,092,294	T381P	probably benign	Het
Cryba1	T	C	11: 77,719,529	N120S	probably benign	Het
Cyfip2	G	A	11: 46,242,459	R805*	probably null	Het
Dnah7c	C	A	1: 46,657,243	P2095Q	probably damaging	Het
Eif3k	T	C	7: 28,977,226	E110G	possibly damaging	Het
Extl2	A	G	3: 116,027,352	M283V	probably damaging	Het
Extl2	T	A	3: 116,027,353	M283K	probably damaging	Het
Focad	T	C	4: 88,403,386	I1658T	probably benign	Het
Fstl5	A	T	3: 76,322,225	H111L	probably damaging	Het
Garnl3	A	G	2: 33,002,773		probably null	Het
Gm3633	T	A	14: 42,640,622		probably benign	Het
Il4i1	T	A	7: 44,836,539		probably null	Het
Kcnj6	A	T	16: 94,762,677	C321S	probably damaging	Het
Kif20a	A	T	18: 34,628,493	Y313F	probably benign	Het
Kmt2d	T	G	15: 98,857,393		probably benign	Het
Kynu	T	A	2: 43,563,110	Y48*	probably null	Het
Ly9	T	C	1: 171,605,279	I55M	probably damaging	Het
Mgme1	T	C	2: 144,276,519	V237A	probably damaging	Het
Mmp16	T	A	4: 17,853,800	L27H	probably benign	Het
Myh1	A	C	11: 67,224,393	D1918A	probably damaging	Het
Myo5a	G	A	9: 75,140,688	C266Y	probably damaging	Het
Nckap5l	A	G	15: 99,426,468	I718T	probably benign	Het
Nptx1	A	G	11: 119,546,650		probably null	Het
Olfr180	A	G	16: 58,915,988	Y218H	probably damaging	Het
Olfr502	A	G	7: 108,523,170	F260S	probably damaging	Het
Olfr682-ps1	T	A	7: 105,126,618	M228L	probably benign	Het
Phc3	T	A	3: 30,914,531	K783*	probably null	Het
Pkdrej	A	T	15: 85,820,881	C285S	probably damaging	Het
Pot1b	T	A	17: 55,653,474	T619S	possibly damaging	Het
Psg21	A	T	7: 18,652,284	V259E	probably damaging	Het
Pvr	A	C	7: 19,918,630	I120S	probably benign	Het
Rbm17	T	G	2: 11,598,090	I68L	probably benign	Het
Rnf138	C	T	18: 21,002,142	P28L	probably damaging	Het
Rnf207	C	T	4: 152,312,532	C385Y	possibly damaging	Het
Serping1	A	C	2: 84,770,233	V255G	probably benign	Het
Slc25a3	A	T	10: 91,119,705	V91E	probably damaging	Het
Slc26a8	T	C	17: 28,638,481	D896G	probably benign	Het
Slc27a5	T	A	7: 12,997,516	T183S	probably benign	Het
Slc33a1	A	T	3: 63,943,323	F527I	probably benign	Het
Strn4	A	T	7: 16,828,785	D283V	probably damaging	Het
Sult1e1	G	A	5: 87,586,766	T107I	probably damaging	Het
Tango6	G	A	8: 106,742,472		probably null	Het
Tecrl	G	T	5: 83,313,314	P99T	probably damaging	Het
Ticrr	T	C	7: 79,693,957	L1190P	possibly damaging	Het
Timm50	C	T	7: 28,305,945	R349H	probably damaging	Het
Tjp2	A	G	19: 24,101,991	I840T	probably damaging	Het
Tmem173	T	C	18: 35,739,429	H50R	probably damaging	Het
Tmem45a2	T	A	16: 57,047,023	N105I	probably damaging	Het
Zfp148	T	A	16: 33,468,126	C162S	probably damaging	Het
Zfp534	T	C	4: 147,674,481	K577R	probably benign	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GTGATGTGCCCCATACTCAAC -3'
(R):5'- CTGCAATTCAGTGAAGCTTTGC -3'

Sequencing Primer
(F):5'- GTGATGTGCCCCATACTCAACTATAC -3'
(R):5'- CTTTCCTAGTAAGGACATTTTCT -3'

Posted On

2018-10-18