Incidental Mutation 'R6866:Phc3'
List |< first << previous [record 40 of 63] next >> last >|
ID535902
Institutional Source Beutler Lab
Gene Symbol Phc3
Ensembl Gene ENSMUSG00000037652
Gene Namepolyhomeotic 3
SynonymsHPH3, EDR3, E030046K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location30899371-30969415 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 30914531 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 783 (K783*)
Ref Sequence ENSEMBL: ENSMUSP00000136820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046624] [ENSMUST00000064718] [ENSMUST00000108255] [ENSMUST00000129817] [ENSMUST00000152357] [ENSMUST00000168645] [ENSMUST00000177992]
Predicted Effect probably benign
Transcript: ENSMUST00000046624
SMART Domains Protein: ENSMUSP00000037862
Gene: ENSMUSG00000037652

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 512 538 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000064718
AA Change: K786*
SMART Domains Protein: ENSMUSP00000065617
Gene: ENSMUSG00000037652
AA Change: K786*

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 470 496 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 541 571 N/A INTRINSIC
low complexity region 610 618 N/A INTRINSIC
low complexity region 628 656 N/A INTRINSIC
PDB:2L8E|A 745 781 1e-8 PDB
low complexity region 849 868 N/A INTRINSIC
SAM 884 951 4.04e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108255
AA Change: K783*
SMART Domains Protein: ENSMUSP00000103890
Gene: ENSMUSG00000037652
AA Change: K783*

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129817
AA Change: K816*
SMART Domains Protein: ENSMUSP00000114916
Gene: ENSMUSG00000037652
AA Change: K816*

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.7e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152357
SMART Domains Protein: ENSMUSP00000117614
Gene: ENSMUSG00000037652

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 201 222 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168645
AA Change: K816*
SMART Domains Protein: ENSMUSP00000130142
Gene: ENSMUSG00000037652
AA Change: K816*

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.6e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177992
AA Change: K783*
SMART Domains Protein: ENSMUSP00000136820
Gene: ENSMUSG00000037652
AA Change: K783*

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Phc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Phc3 APN 3 30936475 missense probably damaging 0.98
IGL00985:Phc3 APN 3 30914197 missense probably benign 0.13
IGL01340:Phc3 APN 3 30929884 missense possibly damaging 0.85
IGL01450:Phc3 APN 3 30914504 missense probably damaging 1.00
IGL01546:Phc3 APN 3 30961739 missense probably damaging 1.00
IGL01918:Phc3 APN 3 30914416 critical splice donor site probably null
IGL02178:Phc3 APN 3 30929863 missense possibly damaging 0.47
IGL02210:Phc3 APN 3 30936709 missense probably damaging 0.99
IGL02330:Phc3 APN 3 30936381 missense probably damaging 1.00
IGL02516:Phc3 APN 3 30948793 missense probably damaging 1.00
IGL03030:Phc3 APN 3 30936853 missense probably damaging 1.00
See_saw UTSW 3 30937049 nonsense probably null
R1228:Phc3 UTSW 3 30922255 missense possibly damaging 0.71
R1239:Phc3 UTSW 3 30914130 missense probably damaging 1.00
R1319:Phc3 UTSW 3 30929869 missense probably damaging 0.97
R1521:Phc3 UTSW 3 30936575 missense possibly damaging 0.89
R1772:Phc3 UTSW 3 30961820 missense probably damaging 1.00
R1793:Phc3 UTSW 3 30948716 missense probably damaging 1.00
R1879:Phc3 UTSW 3 30914458 missense probably damaging 1.00
R2171:Phc3 UTSW 3 30950929 missense probably damaging 1.00
R2419:Phc3 UTSW 3 30950878 missense probably damaging 0.99
R2863:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R2864:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R3700:Phc3 UTSW 3 30914128 missense probably damaging 1.00
R3980:Phc3 UTSW 3 30936931 missense probably damaging 0.99
R4222:Phc3 UTSW 3 30936819 missense probably damaging 1.00
R4223:Phc3 UTSW 3 30936819 missense probably damaging 1.00
R4584:Phc3 UTSW 3 30965882 missense possibly damaging 0.46
R4928:Phc3 UTSW 3 30950919 missense probably damaging 1.00
R5100:Phc3 UTSW 3 30922199 missense possibly damaging 0.71
R5340:Phc3 UTSW 3 30907467 missense probably damaging 1.00
R5656:Phc3 UTSW 3 30965866 missense probably damaging 0.98
R5840:Phc3 UTSW 3 30936583 missense possibly damaging 0.95
R6022:Phc3 UTSW 3 30930025 missense probably damaging 1.00
R6061:Phc3 UTSW 3 30914529 missense probably damaging 1.00
R6177:Phc3 UTSW 3 30942565 missense probably damaging 1.00
R6188:Phc3 UTSW 3 30937049 nonsense probably null
R6870:Phc3 UTSW 3 30936761 missense probably damaging 1.00
R7155:Phc3 UTSW 3 30914197 missense probably benign 0.01
R7603:Phc3 UTSW 3 30907452 missense probably damaging 0.97
R7874:Phc3 UTSW 3 30936714 missense probably benign 0.00
R8422:Phc3 UTSW 3 30929890 nonsense probably null
R8877:Phc3 UTSW 3 30914122 missense probably damaging 1.00
X0025:Phc3 UTSW 3 30965886 missense probably damaging 0.96
Z1176:Phc3 UTSW 3 30936597 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTCCCTTGCAGTTCTGAAAAG -3'
(R):5'- ATATCATTACCTTGTTAGGGGTGTC -3'

Sequencing Primer
(F):5'- CCCTTGCAGTTCTGAAAAGGACATTG -3'
(R):5'- GATATACACAGGGGTCATTTTTGAC -3'
Posted On2018-10-18