Incidental Mutation 'R6866:Slc27a5'
ID535917
Institutional Source Beutler Lab
Gene Symbol Slc27a5
Ensembl Gene ENSMUSG00000030382
Gene Namesolute carrier family 27 (fatty acid transporter), member 5
SynonymsVLCSH2, FATP5, FACVL3, VLCS-H2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12988346-12998192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12997516 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 183 (T183S)
Ref Sequence ENSEMBL: ENSMUSP00000112495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032539] [ENSMUST00000120903]
Predicted Effect probably benign
Transcript: ENSMUST00000032539
AA Change: T183S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032539
Gene: ENSMUSG00000030382
AA Change: T183S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 557 1.3e-64 PFAM
Pfam:AMP-binding_C 565 641 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120903
AA Change: T183S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112495
Gene: ENSMUSG00000030382
AA Change: T183S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 414 2e-42 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117208
Gene: ENSMUSG00000030382
AA Change: T54S

DomainStartEndE-ValueType
Pfam:AMP-binding 1 102 3.3e-8 PFAM
Pfam:AMP-binding 100 195 1.3e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of very long-chain acyl-CoA synthetase (VLCS). It is capable of activating very long-chain fatty-acids containing 24- and 26-carbons. It is expressed in liver and associated with endoplasmic reticulum but not with peroxisomes. Its primary role is in fatty acid elongation or complex lipid synthesis rather than in degradation. This gene has a mouse ortholog. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Slc27a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc27a5 APN 7 12988639 missense probably benign 0.08
IGL00906:Slc27a5 APN 7 12991057 missense probably benign 0.00
IGL01067:Slc27a5 APN 7 12989072 missense probably damaging 1.00
IGL02101:Slc27a5 APN 7 12993343 missense possibly damaging 0.95
IGL02148:Slc27a5 APN 7 12994951 missense probably damaging 0.97
IGL02165:Slc27a5 APN 7 12994948 missense probably damaging 0.99
IGL02324:Slc27a5 APN 7 12997560 missense probably benign 0.00
IGL02879:Slc27a5 APN 7 12995044 splice site probably benign
R1519:Slc27a5 UTSW 7 12988459 splice site probably null
R1662:Slc27a5 UTSW 7 12991246 missense probably damaging 1.00
R1774:Slc27a5 UTSW 7 12997607 nonsense probably null
R2012:Slc27a5 UTSW 7 12997707 missense probably damaging 0.98
R2020:Slc27a5 UTSW 7 12993412 missense probably damaging 1.00
R2886:Slc27a5 UTSW 7 12989560 unclassified probably benign
R4234:Slc27a5 UTSW 7 12988443 missense probably benign 0.01
R4855:Slc27a5 UTSW 7 12988633 missense probably benign 0.00
R5126:Slc27a5 UTSW 7 12991320 missense probably damaging 1.00
R5450:Slc27a5 UTSW 7 12994942 missense probably benign 0.04
R5712:Slc27a5 UTSW 7 12998083 unclassified probably benign
R6302:Slc27a5 UTSW 7 12988552 missense probably damaging 1.00
R6346:Slc27a5 UTSW 7 12990972 missense possibly damaging 0.75
R6921:Slc27a5 UTSW 7 12991208 missense probably damaging 1.00
R7329:Slc27a5 UTSW 7 12991162 missense possibly damaging 0.75
R8019:Slc27a5 UTSW 7 12989402 missense probably damaging 1.00
Z1177:Slc27a5 UTSW 7 12988855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACGTCTGACTTCCCTTGC -3'
(R):5'- CTCCAGAGACCTTTGTGGATGC -3'

Sequencing Primer
(F):5'- ACGTCTGACTTCCCTTGCTTCTG -3'
(R):5'- CCAGAGACCTTTGTGGATGCTTTAG -3'
Posted On2018-10-18