Incidental Mutation 'R6866:Cdca2'
List |< first << previous [record 11 of 63] next >> last >|
ID535940
Institutional Source Beutler Lab
Gene Symbol Cdca2
Ensembl Gene ENSMUSG00000048922
Gene Namecell division cycle associated 2
Synonyms2610311M19Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001110162, NM_175384

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location67676331-67715841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67693666 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 526 (E526G)
Ref Sequence ENSEMBL: ENSMUSP00000127571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132705] [ENSMUST00000150006] [ENSMUST00000163100]
Predicted Effect probably benign
Transcript: ENSMUST00000130922
Predicted Effect
SMART Domains Protein: ENSMUSP00000123664
Gene: ENSMUSG00000048922
AA Change: E80G

DomainStartEndE-ValueType
low complexity region 70 83 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132705
AA Change: E526G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115633
Gene: ENSMUSG00000048922
AA Change: E526G

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 4.3e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150006
AA Change: E526G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117847
Gene: ENSMUSG00000048922
AA Change: E526G

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 5.4e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163100
AA Change: E526G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127571
Gene: ENSMUSG00000048922
AA Change: E526G

DomainStartEndE-ValueType
Pfam:PP1_bind 379 436 4.1e-27 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a targeting subunit of the cell-cycle associated protein, protein phosphatase 1, with a role in targeting this protein to chromatin during anaphase. These two proteins comprise a phosphatase complex that is involved in nuclear envelope reformation and regulation of the DNA damage response. The encoded protein may also play a role in cancer progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Cdca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Cdca2 APN 14 67714697 missense probably damaging 0.99
IGL01413:Cdca2 APN 14 67677894 missense probably damaging 0.98
IGL01962:Cdca2 APN 14 67705723 missense probably damaging 0.99
IGL01982:Cdca2 APN 14 67677719 missense probably damaging 0.98
IGL02198:Cdca2 APN 14 67694996 missense probably benign 0.00
IGL02208:Cdca2 APN 14 67713140 missense probably damaging 0.99
IGL02883:Cdca2 APN 14 67707497 missense probably damaging 1.00
IGL03069:Cdca2 APN 14 67714936 splice site probably benign
F5493:Cdca2 UTSW 14 67677692 missense probably damaging 0.99
IGL03046:Cdca2 UTSW 14 67700022 intron probably benign
R0254:Cdca2 UTSW 14 67677178 missense probably damaging 0.99
R0350:Cdca2 UTSW 14 67713119 missense probably benign 0.02
R0368:Cdca2 UTSW 14 67700347 missense possibly damaging 0.89
R0398:Cdca2 UTSW 14 67697962 missense probably damaging 0.98
R0790:Cdca2 UTSW 14 67680291 missense probably benign
R1104:Cdca2 UTSW 14 67693682 missense probably damaging 0.99
R1474:Cdca2 UTSW 14 67714906 intron probably benign
R1658:Cdca2 UTSW 14 67677699 missense possibly damaging 0.93
R1782:Cdca2 UTSW 14 67677811 missense probably benign 0.22
R2150:Cdca2 UTSW 14 67714809 missense probably damaging 1.00
R2154:Cdca2 UTSW 14 67676976 missense probably damaging 0.99
R2155:Cdca2 UTSW 14 67714838 missense probably damaging 1.00
R2862:Cdca2 UTSW 14 67698090 missense probably damaging 1.00
R3156:Cdca2 UTSW 14 67698163 missense possibly damaging 0.91
R3840:Cdca2 UTSW 14 67680271 nonsense probably null
R4043:Cdca2 UTSW 14 67704006 missense probably benign 0.11
R4293:Cdca2 UTSW 14 67714850 missense probably benign 0.06
R4679:Cdca2 UTSW 14 67714966 missense possibly damaging 0.68
R4777:Cdca2 UTSW 14 67713140 missense probably damaging 0.99
R4829:Cdca2 UTSW 14 67693753 critical splice acceptor site probably null
R4843:Cdca2 UTSW 14 67676976 missense probably damaging 1.00
R5031:Cdca2 UTSW 14 67713153 missense probably damaging 1.00
R5181:Cdca2 UTSW 14 67680165 missense probably damaging 0.98
R5331:Cdca2 UTSW 14 67677471 missense possibly damaging 0.91
R5490:Cdca2 UTSW 14 67680284 missense possibly damaging 0.91
R5695:Cdca2 UTSW 14 67705629 critical splice donor site probably null
R6246:Cdca2 UTSW 14 67677828 nonsense probably null
R6928:Cdca2 UTSW 14 67705744 missense probably damaging 0.98
R6955:Cdca2 UTSW 14 67715004 start codon destroyed probably null 0.53
R6986:Cdca2 UTSW 14 67694997 missense probably benign 0.27
R7080:Cdca2 UTSW 14 67698102 missense probably damaging 0.99
R7092:Cdca2 UTSW 14 67707351 critical splice donor site probably null
R7292:Cdca2 UTSW 14 67677877 nonsense probably null
R7308:Cdca2 UTSW 14 67694991 missense probably benign
R7310:Cdca2 UTSW 14 67713224 missense probably damaging 1.00
R7877:Cdca2 UTSW 14 67677216 missense probably benign
R8012:Cdca2 UTSW 14 67677372 missense probably benign 0.23
R8080:Cdca2 UTSW 14 67677555 nonsense probably null
R8772:Cdca2 UTSW 14 67698080 missense probably damaging 0.98
Z1088:Cdca2 UTSW 14 67700298 missense probably benign 0.12
Z1177:Cdca2 UTSW 14 67680244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGATTAAGCGGACACTGACG -3'
(R):5'- TGGGTTTTAGCACCGAGTAC -3'

Sequencing Primer
(F):5'- GCAGAACTAGTCCCAGGTCATTAG -3'
(R):5'- TTTTAGCACCGAGTACTGAAGG -3'
Posted On2018-10-18