Incidental Mutation 'R6866:Olfr180'
ID535946
Institutional Source Beutler Lab
Gene Symbol Olfr180
Ensembl Gene ENSMUSG00000090629
Gene Nameolfactory receptor 180
SynonymsMOR184-11P, GA_x54KRFPKG5P-55134972-55134019, Olfr1563-ps1, MOR184-9, MOR184-11P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location58914285-58929392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58915988 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 218 (Y218H)
Ref Sequence ENSEMBL: ENSMUSP00000145601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171656] [ENSMUST00000205883] [ENSMUST00000206168]
Predicted Effect probably damaging
Transcript: ENSMUST00000171656
AA Change: Y218H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128358
Gene: ENSMUSG00000090629
AA Change: Y218H

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-51 PFAM
Pfam:7tm_1 41 313 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205883
Predicted Effect probably damaging
Transcript: ENSMUST00000206168
AA Change: Y218H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Olfr180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr180 APN 16 58915850 missense probably benign 0.01
IGL01759:Olfr180 APN 16 58915928 missense probably damaging 0.99
IGL02499:Olfr180 APN 16 58916251 missense probably damaging 1.00
IGL02890:Olfr180 APN 16 58916374 missense probably benign 0.03
R1123:Olfr180 UTSW 16 58916334 nonsense probably null
R1292:Olfr180 UTSW 16 58915771 missense probably damaging 1.00
R2983:Olfr180 UTSW 16 58916567 missense probably benign 0.00
R3894:Olfr180 UTSW 16 58916339 missense probably benign 0.28
R4176:Olfr180 UTSW 16 58916584 missense probably benign 0.01
R4666:Olfr180 UTSW 16 58916584 missense probably benign 0.01
R5058:Olfr180 UTSW 16 58916072 missense probably benign 0.00
R5375:Olfr180 UTSW 16 58915885 missense possibly damaging 0.83
R5998:Olfr180 UTSW 16 58916630 missense probably benign
R6225:Olfr180 UTSW 16 58916182 missense probably benign 0.32
R6315:Olfr180 UTSW 16 58916246 missense probably damaging 1.00
R6380:Olfr180 UTSW 16 58916264 missense probably damaging 1.00
R7513:Olfr180 UTSW 16 58915932 missense probably damaging 1.00
R7582:Olfr180 UTSW 16 58916047 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CAGGCTGTAAATAAAAGGGTTTAGC -3'
(R):5'- GCATTCCTTGATTCATGTAGGG -3'

Sequencing Primer
(F):5'- CTGTAAATAAAAGGGTTTAGCAAAGG -3'
(R):5'- CATGTAGGGTGTCTCTTAAGGTTAAC -3'
Posted On2018-10-18