Incidental Mutation 'R6866:Kif20a'
List |< first << previous [record 27 of 63] next >> last >|
ID535953
Institutional Source Beutler Lab
Gene Symbol Kif20a
Ensembl Gene ENSMUSG00000003779
Gene Namekinesin family member 20A
SynonymsRabkinesin-6, Rab6kifl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location34624624-34633265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34628493 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 313 (Y313F)
Ref Sequence ENSEMBL: ENSMUSP00000130045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003876] [ENSMUST00000025228] [ENSMUST00000097626] [ENSMUST00000115765] [ENSMUST00000115766] [ENSMUST00000133181] [ENSMUST00000166044] [ENSMUST00000167161]
Predicted Effect probably benign
Transcript: ENSMUST00000003876
SMART Domains Protein: ENSMUSP00000003876
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025228
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097626
SMART Domains Protein: ENSMUSP00000095229
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 3e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
BROMO 705 813 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115765
SMART Domains Protein: ENSMUSP00000111431
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 5e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115766
SMART Domains Protein: ENSMUSP00000111432
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 337 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
BROMO 708 816 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133181
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166044
AA Change: Y313F

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132659
Gene: ENSMUSG00000003779
AA Change: Y313F

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167161
AA Change: Y313F

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130045
Gene: ENSMUSG00000003779
AA Change: Y313F

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Kif20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02448:Kif20a APN 18 34628454 missense possibly damaging 0.49
IGL02654:Kif20a APN 18 34632023 missense probably damaging 1.00
IGL02739:Kif20a APN 18 34628943 nonsense probably null
R0600:Kif20a UTSW 18 34629209 missense probably damaging 1.00
R0748:Kif20a UTSW 18 34628188 splice site probably benign
R0856:Kif20a UTSW 18 34631218 missense probably benign
R1278:Kif20a UTSW 18 34626777 missense probably benign 0.00
R1752:Kif20a UTSW 18 34631581 missense possibly damaging 0.82
R2036:Kif20a UTSW 18 34628462 missense possibly damaging 0.91
R2143:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R2144:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R4231:Kif20a UTSW 18 34632038 missense probably benign
R4372:Kif20a UTSW 18 34629478 missense probably damaging 1.00
R4426:Kif20a UTSW 18 34631941 missense probably damaging 1.00
R4584:Kif20a UTSW 18 34632611 missense probably damaging 1.00
R5524:Kif20a UTSW 18 34630625 critical splice donor site probably null
R5867:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5869:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5949:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5958:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5959:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5967:Kif20a UTSW 18 34630527 missense probably benign 0.10
R5969:Kif20a UTSW 18 34632415 missense probably benign 0.01
R6175:Kif20a UTSW 18 34628146 missense probably damaging 0.98
R6490:Kif20a UTSW 18 34629490 missense possibly damaging 0.84
R6694:Kif20a UTSW 18 34625526 missense probably damaging 0.98
R7129:Kif20a UTSW 18 34632535 missense probably benign 0.00
R7217:Kif20a UTSW 18 34629560 missense probably benign 0.14
R7397:Kif20a UTSW 18 34627676 missense probably damaging 1.00
R7585:Kif20a UTSW 18 34625538 missense probably benign 0.03
R8302:Kif20a UTSW 18 34631977 missense probably damaging 1.00
R8306:Kif20a UTSW 18 34628391 missense probably benign 0.00
R8325:Kif20a UTSW 18 34626922 missense possibly damaging 0.68
R8697:Kif20a UTSW 18 34628531 missense probably benign 0.19
X0027:Kif20a UTSW 18 34625530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCAAAATGAGATTCTCCACG -3'
(R):5'- AAGCTCTGGTTCTTGCGACC -3'

Sequencing Primer
(F):5'- TGAGATTCTCCACGGTTAATGAC -3'
(R):5'- ATCCAATTGAGATCTGGAGCC -3'
Posted On2018-10-18