Incidental Mutation 'R6866:Tmem173'
ID535954
Institutional Source Beutler Lab
Gene Symbol Tmem173
Ensembl Gene ENSMUSG00000024349
Gene Nametransmembrane protein 173
Synonyms2610307O08Rik, MPYS, Sting, ERIS
MMRRC Submission
Accession Numbers

Ncbi RefSeq:NM_028261.1; MGI: 1919762

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location35733678-35740554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35739429 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 50 (H50R)
Ref Sequence ENSEMBL: ENSMUSP00000111393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115728]
PDB Structure
Immune activator bound to receptor [X-RAY DIFFRACTION]
mSTING/c-di-GMP [X-RAY DIFFRACTION]
mSTING [X-RAY DIFFRACTION]
Crystal structure of mSting in complex with c[G(2',5')pA(3',5')p] [X-RAY DIFFRACTION]
Crystal structure of mSting in complex with c[G(3',5')pA(3',5')p] [X-RAY DIFFRACTION]
Crystal structure of mSting in complex with DMXAA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000115728
AA Change: H50R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111393
Gene: ENSMUSG00000024349
AA Change: H50R

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:TMEM173 44 336 4.7e-125 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype Strain: 3817418; 4939597
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to viral infection and abnormal innate immunity. Mice homozygous for an ENU-induced allele exhibit altered response to bacterial and viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Tmem173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tmem173 APN 18 35734567 missense probably damaging 0.99
R0226:Tmem173 UTSW 18 35739088 missense probably benign
R0388:Tmem173 UTSW 18 35735111 unclassified probably null
R0924:Tmem173 UTSW 18 35735101 critical splice donor site probably null
R2102:Tmem173 UTSW 18 35735237 missense probably damaging 1.00
R4159:Tmem173 UTSW 18 35739219 missense probably damaging 1.00
R4604:Tmem173 UTSW 18 35738690 missense probably damaging 0.97
R6209:Tmem173 UTSW 18 35736102 missense probably damaging 1.00
R7008:Tmem173 UTSW 18 35735171 missense probably damaging 1.00
R7083:Tmem173 UTSW 18 35734650 missense probably damaging 1.00
R7492:Tmem173 UTSW 18 35738713 missense probably damaging 1.00
R7726:Tmem173 UTSW 18 35735265 missense probably damaging 1.00
R7899:Tmem173 UTSW 18 35734573 missense probably damaging 1.00
R7982:Tmem173 UTSW 18 35734573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTCAGCTGATGATGTTCAG -3'
(R):5'- TGACTAGTCAGGACCTTAGGC -3'

Sequencing Primer
(F):5'- CTCAGCTGATGATGTTCAGGGAAG -3'
(R):5'- CCCAGAAGCATAGCTGTGGATTTC -3'
Posted On2018-10-18