Incidental Mutation 'R6867:Olfr1037'
ID535959
Institutional Source Beutler Lab
Gene Symbol Olfr1037
Ensembl Gene ENSMUSG00000075205
Gene Nameolfactory receptor 1037
SynonymsMOR171-52, MOR256-34P, GA_x6K02T2Q125-47560740-47559775
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86084671-86087385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86085738 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 13 (I13T)
Ref Sequence ENSEMBL: ENSMUSP00000150319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099911] [ENSMUST00000213333] [ENSMUST00000216020] [ENSMUST00000216886]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099911
AA Change: I13T

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097495
Gene: ENSMUSG00000075205
AA Change: I13T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213333
AA Change: I13T

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216020
AA Change: I13T

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216886
AA Change: I13T

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Olfr1037
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Olfr1037 APN 2 86085640 missense probably benign 0.05
IGL02534:Olfr1037 APN 2 86085369 missense probably damaging 1.00
IGL03204:Olfr1037 APN 2 86085671 nonsense probably null
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0666:Olfr1037 UTSW 2 86085213 missense probably benign 0.03
R0732:Olfr1037 UTSW 2 86085584 missense probably benign 0.00
R1167:Olfr1037 UTSW 2 86085291 missense probably benign 0.16
R1899:Olfr1037 UTSW 2 86085720 missense probably benign
R3082:Olfr1037 UTSW 2 86085709 missense probably benign
R3847:Olfr1037 UTSW 2 86085407 nonsense probably null
R3848:Olfr1037 UTSW 2 86085407 nonsense probably null
R4079:Olfr1037 UTSW 2 86085312 missense possibly damaging 0.67
R4193:Olfr1037 UTSW 2 86085700 missense probably benign 0.01
R4832:Olfr1037 UTSW 2 86084846 missense probably benign 0.00
R5244:Olfr1037 UTSW 2 86084956 missense probably damaging 1.00
R5643:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5644:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5974:Olfr1037 UTSW 2 86084881 missense probably benign
R6136:Olfr1037 UTSW 2 86084901 missense probably damaging 1.00
R6189:Olfr1037 UTSW 2 86084913 missense possibly damaging 0.53
R6483:Olfr1037 UTSW 2 86085440 missense probably benign 0.00
R6569:Olfr1037 UTSW 2 86085505 missense possibly damaging 0.87
R6724:Olfr1037 UTSW 2 86085357 missense possibly damaging 0.81
R7081:Olfr1037 UTSW 2 86085595 missense probably damaging 1.00
R7207:Olfr1037 UTSW 2 86084815 missense possibly damaging 0.93
R7436:Olfr1037 UTSW 2 86084907 missense probably damaging 1.00
X0062:Olfr1037 UTSW 2 86085114 missense probably damaging 1.00
Z1088:Olfr1037 UTSW 2 86084982 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAGTCTCCAGAAACTTGGGG -3'
(R):5'- TTCTTGCTAGGCTACTGTATTGAC -3'

Sequencing Primer
(F):5'- TCTCCAGAAACTTGGGGGCTAC -3'
(R):5'- GCTAGGCTACTGTATTGACATCAAC -3'
Posted On2018-10-18