Incidental Mutation 'R6867:Ipp'
ID535966
Institutional Source Beutler Lab
Gene Symbol Ipp
Ensembl Gene ENSMUSG00000028696
Gene NameIAP promoted placental gene
SynonymsD4Jhu8, Mipp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6867 (G1)
Quality Score87.0076
Status Validated
Chromosome4
Chromosomal Location116507549-116538243 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 116510409 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030461] [ENSMUST00000106479]
Predicted Effect probably null
Transcript: ENSMUST00000030461
SMART Domains Protein: ENSMUSP00000030461
Gene: ENSMUSG00000028696

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106479
SMART Domains Protein: ENSMUSP00000102088
Gene: ENSMUSG00000028696

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 50 amino acid repeat which interacts with actin. Transcript variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Ipp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ipp APN 4 116532659 missense possibly damaging 0.93
IGL01399:Ipp APN 4 116515187 missense probably damaging 1.00
IGL01934:Ipp APN 4 116510655 missense probably damaging 0.99
IGL02805:Ipp APN 4 116529688 missense possibly damaging 0.92
Iguacu UTSW 4 116537938 nonsense probably null
R0582:Ipp UTSW 4 116515467 missense probably damaging 1.00
R0669:Ipp UTSW 4 116537876 missense probably damaging 1.00
R1121:Ipp UTSW 4 116520675 missense probably benign 0.00
R1394:Ipp UTSW 4 116537912 nonsense probably null
R1738:Ipp UTSW 4 116530421 missense probably benign 0.00
R2021:Ipp UTSW 4 116515368 missense probably benign 0.26
R3103:Ipp UTSW 4 116524249 missense possibly damaging 0.65
R4372:Ipp UTSW 4 116515363 missense possibly damaging 0.90
R4439:Ipp UTSW 4 116515077 missense probably benign 0.00
R4571:Ipp UTSW 4 116530458 missense probably damaging 1.00
R5134:Ipp UTSW 4 116515457 missense possibly damaging 0.65
R5503:Ipp UTSW 4 116537938 nonsense probably null
R5519:Ipp UTSW 4 116510767 missense possibly damaging 0.76
R5640:Ipp UTSW 4 116520689 missense possibly damaging 0.67
R5768:Ipp UTSW 4 116510770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTCCTAACTGTAGTGATACAAC -3'
(R):5'- GAATTGTCAGCAGCCTTGGG -3'

Sequencing Primer
(F):5'- ACTGTAGTGATACAACTCTTTTCTGC -3'
(R):5'- GGCACTCCTCCTTAGACATGGTG -3'
Posted On2018-10-18