Incidental Mutation 'R6867:Tesk2'
ID535967
Institutional Source Beutler Lab
Gene Symbol Tesk2
Ensembl Gene ENSMUSG00000033985
Gene Nametestis-specific kinase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116720948-116805956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116801798 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 291 (C291S)
Ref Sequence ENSEMBL: ENSMUSP00000041009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030451] [ENSMUST00000045542] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459] [ENSMUST00000145468]
Predicted Effect probably benign
Transcript: ENSMUST00000030451
SMART Domains Protein: ENSMUSP00000030451
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 39 171 3.1e-46 PFAM
Pfam:CAF1 164 452 9.9e-40 PFAM
Pfam:zf-CCCH 297 322 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045542
AA Change: C291S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985
AA Change: C291S

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106455
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106456
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000106459
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145468
SMART Domains Protein: ENSMUSP00000117019
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
Pfam:CAF1 1 184 2.2e-58 PFAM
Meta Mutation Damage Score 0.9666 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Tesk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Tesk2 APN 4 116771801 missense possibly damaging 0.68
IGL02051:Tesk2 APN 4 116751184 missense probably damaging 1.00
IGL02223:Tesk2 APN 4 116741825 nonsense probably null
IGL02747:Tesk2 APN 4 116802879 missense probably benign 0.31
IGL02942:Tesk2 APN 4 116771820 missense probably damaging 0.99
R1804:Tesk2 UTSW 4 116800621 unclassified probably benign
R1936:Tesk2 UTSW 4 116741824 missense probably benign 0.23
R1986:Tesk2 UTSW 4 116751193 missense probably damaging 1.00
R2414:Tesk2 UTSW 4 116801757 missense possibly damaging 0.96
R4632:Tesk2 UTSW 4 116741712 missense probably benign 0.01
R4896:Tesk2 UTSW 4 116802993 missense probably benign
R5186:Tesk2 UTSW 4 116741896 missense probably damaging 1.00
R5209:Tesk2 UTSW 4 116724698 start gained probably benign
R5278:Tesk2 UTSW 4 116805936 intron probably benign
R5769:Tesk2 UTSW 4 116802315 intron probably null
R6199:Tesk2 UTSW 4 116792170 missense probably damaging 0.98
R6464:Tesk2 UTSW 4 116802849 missense probably damaging 1.00
R6567:Tesk2 UTSW 4 116792164 missense probably damaging 1.00
R7028:Tesk2 UTSW 4 116802687 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACGATGGAACTGTTTTACCC -3'
(R):5'- TCTCTGGAGAGCCTGTACAG -3'

Sequencing Primer
(F):5'- GGAACTACTCCATTTCTGAGGCAG -3'
(R):5'- TCTCTGGAGAGCCTGTACAGATCAG -3'
Posted On2018-10-18