Incidental Mutation 'R6867:Mprip'
ID535986
Institutional Source Beutler Lab
Gene Symbol Mprip
Ensembl Gene ENSMUSG00000005417
Gene Namemyosin phosphatase Rho interacting protein
Synonymsp116Rip, Rhoip3, RIP3, p116 Rho interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location59661305-59780860 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 59749630 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]
Predicted Effect probably null
Transcript: ENSMUST00000066330
SMART Domains Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 249 320 1e-10 BLAST
PH 351 448 3.76e-18 SMART
low complexity region 492 501 N/A INTRINSIC
low complexity region 536 555 N/A INTRINSIC
coiled coil region 636 671 N/A INTRINSIC
Blast:PAC 806 848 2e-10 BLAST
low complexity region 1005 1023 N/A INTRINSIC
low complexity region 1047 1059 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1183 1200 N/A INTRINSIC
coiled coil region 1267 1300 N/A INTRINSIC
coiled coil region 1617 1642 N/A INTRINSIC
coiled coil region 1729 1779 N/A INTRINSIC
coiled coil region 1899 1936 N/A INTRINSIC
coiled coil region 1960 2110 N/A INTRINSIC
coiled coil region 2132 2206 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000072031
SMART Domains Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108751
SMART Domains Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 183 196 N/A INTRINSIC
Blast:PH 216 282 1e-10 BLAST
PH 349 446 3.76e-18 SMART
low complexity region 490 499 N/A INTRINSIC
low complexity region 534 553 N/A INTRINSIC
coiled coil region 634 669 N/A INTRINSIC
coiled coil region 690 840 N/A INTRINSIC
coiled coil region 862 936 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000116371
SMART Domains Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132620
SMART Domains Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Blast:PH 101 167 9e-11 BLAST
PH 198 295 3.76e-18 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 383 402 N/A INTRINSIC
coiled coil region 482 517 N/A INTRINSIC
coiled coil region 538 688 N/A INTRINSIC
coiled coil region 710 784 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133861
SMART Domains Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
PH 373 470 3.76e-18 SMART
low complexity region 514 523 N/A INTRINSIC
low complexity region 558 577 N/A INTRINSIC
coiled coil region 658 693 N/A INTRINSIC
coiled coil region 714 864 N/A INTRINSIC
coiled coil region 886 960 N/A INTRINSIC
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Mprip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mprip APN 11 59748591 missense probably benign 0.07
IGL00563:Mprip APN 11 59752617 missense probably damaging 1.00
IGL00905:Mprip APN 11 59772168 missense possibly damaging 0.79
IGL00928:Mprip APN 11 59744752 missense probably damaging 1.00
IGL01161:Mprip APN 11 59731573 missense possibly damaging 0.93
IGL01991:Mprip APN 11 59755012 missense probably damaging 0.99
IGL02491:Mprip APN 11 59770031 missense probably benign 0.13
IGL03030:Mprip APN 11 59741115 splice site probably null
IGL03056:Mprip APN 11 59771692 missense probably damaging 1.00
IGL03293:Mprip APN 11 59696163 missense probably damaging 1.00
R0049:Mprip UTSW 11 59766745 missense probably damaging 0.99
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0147:Mprip UTSW 11 59737073 missense possibly damaging 0.68
R0319:Mprip UTSW 11 59697038 splice site probably benign
R0471:Mprip UTSW 11 59759735 missense probably damaging 1.00
R0539:Mprip UTSW 11 59741117 splice site probably benign
R0627:Mprip UTSW 11 59769972 missense probably damaging 1.00
R0864:Mprip UTSW 11 59758761 missense probably benign
R1218:Mprip UTSW 11 59743814 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1695:Mprip UTSW 11 59752531 missense probably damaging 0.99
R1698:Mprip UTSW 11 59760258 missense possibly damaging 0.75
R1802:Mprip UTSW 11 59755041 missense probably damaging 1.00
R1837:Mprip UTSW 11 59766745 missense probably damaging 0.99
R1862:Mprip UTSW 11 59758221 missense possibly damaging 0.90
R2094:Mprip UTSW 11 59749508 splice site probably benign
R2107:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2108:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2510:Mprip UTSW 11 59749508 splice site probably benign
R3003:Mprip UTSW 11 59727555 missense possibly damaging 0.95
R3115:Mprip UTSW 11 59765403 splice site probably null
R3941:Mprip UTSW 11 59731502 splice site probably benign
R4347:Mprip UTSW 11 59759453 missense possibly damaging 0.86
R4603:Mprip UTSW 11 59731573 missense probably damaging 1.00
R4807:Mprip UTSW 11 59758020 missense probably benign 0.00
R5011:Mprip UTSW 11 59759895 missense possibly damaging 0.75
R5338:Mprip UTSW 11 59760573 missense probably damaging 1.00
R5549:Mprip UTSW 11 59760818 missense probably benign 0.00
R5569:Mprip UTSW 11 59760963 missense probably damaging 1.00
R5604:Mprip UTSW 11 59758467 missense probably benign
R5615:Mprip UTSW 11 59758487 missense probably benign 0.08
R5846:Mprip UTSW 11 59758554 missense probably damaging 1.00
R5970:Mprip UTSW 11 59757721 missense probably damaging 0.96
R6054:Mprip UTSW 11 59758425 missense probably benign
R6452:Mprip UTSW 11 59752783 missense probably damaging 1.00
R6457:Mprip UTSW 11 59758989 missense possibly damaging 0.69
R6544:Mprip UTSW 11 59757726 missense probably benign 0.15
R6750:Mprip UTSW 11 59696131 missense probably damaging 1.00
R6843:Mprip UTSW 11 59759728 missense possibly damaging 0.54
R6851:Mprip UTSW 11 59759015 missense probably damaging 0.99
R7002:Mprip UTSW 11 59761190 missense probably benign 0.22
R7023:Mprip UTSW 11 59737389 missense probably damaging 1.00
R7764:Mprip UTSW 11 59764416 missense probably damaging 0.99
R7765:Mprip UTSW 11 59758221 missense possibly damaging 0.90
R7828:Mprip UTSW 11 59737089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGAGATGGAGGCAGCAGTC -3'
(R):5'- TGAGGGCTAAACTCTGCTGAC -3'

Sequencing Primer
(F):5'- GCAGCAGTCACCCCAATGG -3'
(R):5'- TCCACTCTGAGAACAGGCATGAG -3'
Posted On2018-10-18