Incidental Mutation 'R6867:Enox1'
ID535992
Institutional Source Beutler Lab
Gene Symbol Enox1
Ensembl Gene ENSMUSG00000022012
Gene Nameecto-NOX disulfide-thiol exchanger 1
SynonymsD230005D02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location77156763-77721760 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 77699299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022589] [ENSMUST00000227662] [ENSMUST00000227831]
Predicted Effect probably null
Transcript: ENSMUST00000022589
SMART Domains Protein: ENSMUSP00000022589
Gene: ENSMUSG00000022012

DomainStartEndE-ValueType
low complexity region 95 105 N/A INTRINSIC
RRM 143 209 2.41e-8 SMART
low complexity region 233 251 N/A INTRINSIC
coiled coil region 307 342 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
coiled coil region 425 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000227662
Predicted Effect probably benign
Transcript: ENSMUST00000227831
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in plasma membrane electron transport pathways. The encoded protein has both a hydroquinone (NADH) oxidase activity and a protein disulfide-thiol interchange activity. The two activities cycle with a periodicity of 24 minutes, with one activity being at its peak when the other is at its lowest. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Enox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Enox1 APN 14 77582404 missense possibly damaging 0.63
IGL01376:Enox1 APN 14 77251843 intron probably benign
IGL01509:Enox1 APN 14 77699273 missense probably damaging 1.00
IGL01684:Enox1 APN 14 77579093 missense possibly damaging 0.81
IGL01874:Enox1 APN 14 77579162 missense probably damaging 1.00
IGL03324:Enox1 APN 14 77615485 missense probably damaging 1.00
Soft UTSW 14 77486017 intron probably benign
R0037:Enox1 UTSW 14 77699310 splice site probably benign
R0112:Enox1 UTSW 14 77699198 missense possibly damaging 0.77
R0543:Enox1 UTSW 14 77506959 splice site probably benign
R0569:Enox1 UTSW 14 77637677 missense probably damaging 0.99
R0708:Enox1 UTSW 14 77592912 missense probably benign 0.28
R0811:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R0812:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R1417:Enox1 UTSW 14 77486005 intron probably benign
R1654:Enox1 UTSW 14 77611374 missense possibly damaging 0.87
R1678:Enox1 UTSW 14 77577656 missense probably benign 0.00
R1817:Enox1 UTSW 14 77615475 missense possibly damaging 0.84
R1976:Enox1 UTSW 14 77668793 missense probably benign
R2520:Enox1 UTSW 14 77582399 missense probably damaging 0.99
R3880:Enox1 UTSW 14 77611386 missense possibly damaging 0.49
R4096:Enox1 UTSW 14 77577720 missense probably damaging 0.99
R4885:Enox1 UTSW 14 77720850 missense probably damaging 1.00
R4998:Enox1 UTSW 14 77501435 intron probably benign
R5110:Enox1 UTSW 14 77707687 critical splice donor site probably null
R5341:Enox1 UTSW 14 77577656 missense possibly damaging 0.94
R5469:Enox1 UTSW 14 77592974 missense probably benign 0.00
R5596:Enox1 UTSW 14 77579053 missense probably benign 0.42
R5833:Enox1 UTSW 14 77506939 missense probably benign 0.01
R5892:Enox1 UTSW 14 77486017 intron probably benign
R6174:Enox1 UTSW 14 77508187 missense possibly damaging 0.93
R6267:Enox1 UTSW 14 77577764 missense probably damaging 1.00
R7069:Enox1 UTSW 14 77611324 missense probably damaging 0.99
R7219:Enox1 UTSW 14 77720844 missense probably benign 0.15
R7316:Enox1 UTSW 14 77720858 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCCACTTCTAAGAGGGAACAATG -3'
(R):5'- CACGCACTTGAGATGTACATTGC -3'

Sequencing Primer
(F):5'- AGGGAACAATGGCCTGTTTTATAG -3'
(R):5'- GCACTTGAGATGTACATTGCATAATC -3'
Posted On2018-10-18