Mutagenetix > Incidental Mutation

Incidental Mutation 'R6867:Rgl2'

535995

Institutional Source

Beutler Lab

Gene Symbol

Rgl2

Ensembl Gene

ENSMUSG00000041354

Gene Name

ral guanine nucleotide dissociation stimulator-like 2

Synonyms

KE1.5, Rab2l, Rgt2, Rlf

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R6867 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33929543-33937687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33932687 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 235 (D235G)

Ref Sequence

ENSEMBL: ENSMUSP00000041082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]

AlphaFold

Q61193

PDB Structure

STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025161

SMART Domains

Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	127	152	N/A	INTRINSIC
IG	168	292	3.45e0	SMART
IG_like	302	406	4.78e1	SMART
transmembrane domain	416	438	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000047503
AA Change: D235G

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: D235G

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	31	42	N/A	INTRINSIC
low complexity region	44	63	N/A	INTRINSIC
RasGEFN	87	212	9.54e-30	SMART
RasGEF	239	514	7.15e-106	SMART
low complexity region	578	592	N/A	INTRINSIC
low complexity region	602	619	N/A	INTRINSIC
low complexity region	633	648	N/A	INTRINSIC
RA	649	736	2.05e-19	SMART
low complexity region	737	762	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173284

SMART Domains

Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

Domain	Start	End	E-Value	Type
Blast:RasGEF	2	67	1e-35	BLAST
PDB:4JGW\|B	2	67	1e-35	PDB
SCOP:d1bkds_	2	94	3e-16	SMART
low complexity region	131	145	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
RA	202	289	2.05e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	ACTGCACCACCT	ACT	10: 43,532,725		probably benign	Het
Apold1	T	C	6: 134,984,056	S158P	possibly damaging	Het
Cep162	A	T	9: 87,217,081	L788*	probably null	Het
Cyp7b1	T	C	3: 18,097,230	Y273C	probably damaging	Het
Dlx1	C	A	2: 71,531,009	N122K	probably damaging	Het
Dock10	A	T	1: 80,531,259	I1605K	probably damaging	Het
Enox1	T	C	14: 77,699,299		probably null	Het
F3	T	C	3: 121,729,371	S77P	possibly damaging	Het
Fam186a	T	A	15: 99,945,850	I838L	unknown	Het
Flrt2	T	C	12: 95,779,382	F165L	probably damaging	Het
Gcgr	T	A	11: 120,536,469	V135E	possibly damaging	Het
Gm6741	T	C	17: 91,236,911	L34P	probably benign	Het
Gna13	T	C	11: 109,396,122	M257T	possibly damaging	Het
Hsd11b2	G	A	8: 105,522,317	R147H	probably benign	Het
Hydin	A	G	8: 110,539,802	Y2865C	probably benign	Het
Igdcc3	A	G	9: 65,183,038	N610D	probably damaging	Het
Ipp	T	A	4: 116,510,409		probably null	Het
Kdm5d	A	G	Y: 927,425	T682A	probably benign	Het
Megf8	A	G	7: 25,331,035	Y471C	probably benign	Het
Mprip	T	C	11: 59,749,630		probably null	Het
Myrfl	T	A	10: 116,848,282	R179*	probably null	Het
Nek1	C	A	8: 61,072,330	Q601K	possibly damaging	Het
Neurod4	C	G	10: 130,270,714	K230N	probably damaging	Het
Olfr1037	A	G	2: 86,085,738	I13T	possibly damaging	Het
Olfr374	C	T	8: 72,109,863	T99I	possibly damaging	Het
Orc3	A	G	4: 34,605,539	L114P	probably damaging	Het
Rag1	T	C	2: 101,641,947	D950G	probably damaging	Het
Rasgrp2	G	A	19: 6,413,183	S504N	probably benign	Het
Slc35e2	A	G	4: 155,618,700	E390G	probably benign	Het
Slc39a1	T	A	3: 90,249,452	V105E	probably damaging	Het
Tesk2	T	A	4: 116,801,798	C291S	probably damaging	Het
Tmco3	T	A	8: 13,313,927	F83Y	probably damaging	Het
Trim25	T	C	11: 89,010,887	I336T	probably benign	Het
Ush2a	A	G	1: 188,910,973	I4177M	probably damaging	Het
Veph1	T	A	3: 66,255,037	T67S	probably damaging	Het
Vmn2r43	A	G	7: 8,255,126	F363L	probably benign	Het
Vps28	A	T	15: 76,622,671	I109N	probably damaging	Het
Vps50	A	G	6: 3,517,835	D91G	probably benign	Het
Wdr20	T	C	12: 110,793,699	F340L	probably benign	Het
Wdr95	A	G	5: 149,580,923		probably null	Het
Zfand6	A	G	7: 84,615,914	V193A	probably damaging	Het
Zfp703	C	A	8: 26,978,640	P111T	probably damaging	Het

Other mutations in Rgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Rgl2	APN	17	33933136	missense	probably benign	0.31
IGL00898:Rgl2	APN	17	33933418	missense	possibly damaging	0.95
IGL00965:Rgl2	APN	17	33935936	missense	probably benign	0.00
IGL00985:Rgl2	APN	17	33932101	missense	probably damaging	1.00
IGL02140:Rgl2	APN	17	33933124	missense	probably damaging	1.00
IGL02214:Rgl2	APN	17	33935189	missense	probably benign	0.06
IGL02486:Rgl2	APN	17	33935980	missense	probably damaging	0.97
IGL02579:Rgl2	APN	17	33937160	missense	probably benign	0.08
IGL02976:Rgl2	APN	17	33933962	missense	possibly damaging	0.95
Hypotenuse	UTSW	17	33931739	missense	probably benign	0.00
Pedernales	UTSW	17	33932038	critical splice acceptor site	probably null
PIT4354001:Rgl2	UTSW	17	33933940	missense	possibly damaging	0.80
R0347:Rgl2	UTSW	17	33932738	missense	probably damaging	1.00
R0456:Rgl2	UTSW	17	33936849	splice site	probably null
R0825:Rgl2	UTSW	17	33935159	splice site	probably null
R1742:Rgl2	UTSW	17	33937223	splice site	probably null
R1777:Rgl2	UTSW	17	33931744	missense	probably benign	0.00
R1829:Rgl2	UTSW	17	33933621	missense	probably benign	0.00
R1908:Rgl2	UTSW	17	33932148	missense	probably benign	0.00
R1961:Rgl2	UTSW	17	33933615	missense	probably damaging	1.00
R2102:Rgl2	UTSW	17	33933340	splice site	probably null
R3001:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3002:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3755:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3756:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3978:Rgl2	UTSW	17	33935162	missense	probably benign	0.02
R4042:Rgl2	UTSW	17	33937262	missense	probably damaging	1.00
R4064:Rgl2	UTSW	17	33937108	missense	possibly damaging	0.77
R4204:Rgl2	UTSW	17	33936932	missense	probably benign	0.04
R4661:Rgl2	UTSW	17	33933226	missense	possibly damaging	0.77
R4852:Rgl2	UTSW	17	33937173	missense	probably benign	0.00
R4922:Rgl2	UTSW	17	33932775	unclassified	probably benign
R5119:Rgl2	UTSW	17	33937120	missense	probably benign	0.00
R5167:Rgl2	UTSW	17	33935974	nonsense	probably null
R5279:Rgl2	UTSW	17	33935948	missense	probably benign
R5319:Rgl2	UTSW	17	33933555	missense	probably benign	0.02
R5337:Rgl2	UTSW	17	33934984	missense	probably damaging	0.99
R5881:Rgl2	UTSW	17	33932717	missense	probably benign	0.01
R5945:Rgl2	UTSW	17	33932038	critical splice acceptor site	probably null
R6165:Rgl2	UTSW	17	33931765	missense	probably benign	0.01
R6358:Rgl2	UTSW	17	33937131	splice site	probably null
R7174:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7182:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7183:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7184:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7196:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7203:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7250:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7253:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7254:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7255:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7256:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7282:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7455:Rgl2	UTSW	17	33932683	missense	probably benign	0.32
R7513:Rgl2	UTSW	17	33932555	missense	probably benign
R7752:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7901:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7941:Rgl2	UTSW	17	33931739	missense	probably benign	0.00
R8158:Rgl2	UTSW	17	33936944	missense	probably benign	0.27
R8209:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8226:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8405:Rgl2	UTSW	17	33933724	nonsense	probably null
R8871:Rgl2	UTSW	17	33935000	missense	probably damaging	1.00
R9205:Rgl2	UTSW	17	33936028	missense	probably damaging	1.00
R9591:Rgl2	UTSW	17	33932477	missense	possibly damaging	0.50
X0028:Rgl2	UTSW	17	33932458	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- CTCTGAGGTCAAGGGTCAAC -3'
(R):5'- TCTGAGGCTCTTAAGTGGCC -3'

Sequencing Primer
(F):5'- TCAACTTGACCGGCTTGAGAG -3'
(R):5'- TCTTAAGTGGCCAGGGACCAG -3'

Posted On

2018-10-18